FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640885_at:

>probe:Drosophila_2:1640885_at:550:3; Interrogation_Position=1020; Antisense; ATTGTATTACGACGCAGTGCCCGGA
>probe:Drosophila_2:1640885_at:557:67; Interrogation_Position=1035; Antisense; AGTGCCCGGATTCAAGCGGCAAAAC
>probe:Drosophila_2:1640885_at:618:539; Interrogation_Position=1130; Antisense; GGTATCGAAACCTAGAATCACTCAA
>probe:Drosophila_2:1640885_at:627:33; Interrogation_Position=1146; Antisense; ATCACTCAACTAGCAGTGTGTCGTT
>probe:Drosophila_2:1640885_at:575:515; Interrogation_Position=1161; Antisense; GTGTGTCGTTTATGTCCTAATTGCA
>probe:Drosophila_2:1640885_at:627:643; Interrogation_Position=1188; Antisense; TCTATTAACTATCTTAGTCCGCCGT
>probe:Drosophila_2:1640885_at:259:639; Interrogation_Position=1199; Antisense; TCTTAGTCCGCCGTATTCGAATACA
>probe:Drosophila_2:1640885_at:49:31; Interrogation_Position=1219; Antisense; ATACATACTTTGAATGCGCCGATAT
>probe:Drosophila_2:1640885_at:236:65; Interrogation_Position=1291; Antisense; ATGGGCACTGATATTCGAACGAAAC
>probe:Drosophila_2:1640885_at:439:583; Interrogation_Position=718; Antisense; TGGCTGCTGCTTTTCGCAAGCAACA
>probe:Drosophila_2:1640885_at:688:85; Interrogation_Position=748; Antisense; AGTCGCAGCTACAAGTTAGTCGCCG
>probe:Drosophila_2:1640885_at:335:461; Interrogation_Position=781; Antisense; GATTAGCTAAGCAGCGTCAACTAGG
>probe:Drosophila_2:1640885_at:682:443; Interrogation_Position=849; Antisense; GATGAGCAATCAGTGGTTATACAAC
>probe:Drosophila_2:1640885_at:640:517; Interrogation_Position=882; Antisense; GGGATTCGAGCTGCAAAACTTAAAA

Paste this into a BLAST search page for me
ATTGTATTACGACGCAGTGCCCGGAAGTGCCCGGATTCAAGCGGCAAAACGGTATCGAAACCTAGAATCACTCAAATCACTCAACTAGCAGTGTGTCGTTGTGTGTCGTTTATGTCCTAATTGCATCTATTAACTATCTTAGTCCGCCGTTCTTAGTCCGCCGTATTCGAATACAATACATACTTTGAATGCGCCGATATATGGGCACTGATATTCGAACGAAACTGGCTGCTGCTTTTCGCAAGCAACAAGTCGCAGCTACAAGTTAGTCGCCGGATTAGCTAAGCAGCGTCAACTAGGGATGAGCAATCAGTGGTTATACAACGGGATTCGAGCTGCAAAACTTAAAA

Full Affymetrix probeset data:

Annotations for 1640885_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720