Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640887_at:

>probe:Drosophila_2:1640887_at:80:269; Interrogation_Position=109; Antisense; CAGGAGCTGGCTTACCTCTGCTTGC
>probe:Drosophila_2:1640887_at:607:61; Interrogation_Position=13; Antisense; ATGTCTGCAAGTGATATCGCGGGAA
>probe:Drosophila_2:1640887_at:568:729; Interrogation_Position=149; Antisense; TTGGCTCGCTGGTCACCAATAACCA
>probe:Drosophila_2:1640887_at:418:417; Interrogation_Position=198; Antisense; GAGCGAGGCCAAGCTCGCCATAGAG
>probe:Drosophila_2:1640887_at:255:315; Interrogation_Position=214; Antisense; GCCATAGAGACGCTCGACCATACTA
>probe:Drosophila_2:1640887_at:90:637; Interrogation_Position=227; Antisense; TCGACCATACTACCTTCAAATCTAA
>probe:Drosophila_2:1640887_at:706:657; Interrogation_Position=249; Antisense; TAAGGTTATCCTTGTTTCGAACGCA
>probe:Drosophila_2:1640887_at:450:381; Interrogation_Position=267; Antisense; GAACGCAAGCTTCCGTTCGCTCAAC
>probe:Drosophila_2:1640887_at:40:685; Interrogation_Position=27; Antisense; TATCGCGGGAATTGAACTCACCAGT
>probe:Drosophila_2:1640887_at:369:201; Interrogation_Position=289; Antisense; AACGCCAGTTGCTTGGGCTATGCTC
>probe:Drosophila_2:1640887_at:271:365; Interrogation_Position=361; Antisense; GAATACGATGATTACTCCGAAAGTG
>probe:Drosophila_2:1640887_at:262:3; Interrogation_Position=37; Antisense; ATTGAACTCACCAGTGGACCGACTG
>probe:Drosophila_2:1640887_at:406:69; Interrogation_Position=395; Antisense; ATGGCCCGGGAGACATGCAACTGTA
>probe:Drosophila_2:1640887_at:285:449; Interrogation_Position=75; Antisense; GATCCTTGTGAGAAACCTTCCGGTA

Paste this into a BLAST search page for me
CAGGAGCTGGCTTACCTCTGCTTGCATGTCTGCAAGTGATATCGCGGGAATTGGCTCGCTGGTCACCAATAACCAGAGCGAGGCCAAGCTCGCCATAGAGGCCATAGAGACGCTCGACCATACTATCGACCATACTACCTTCAAATCTAATAAGGTTATCCTTGTTTCGAACGCAGAACGCAAGCTTCCGTTCGCTCAACTATCGCGGGAATTGAACTCACCAGTAACGCCAGTTGCTTGGGCTATGCTCGAATACGATGATTACTCCGAAAGTGATTGAACTCACCAGTGGACCGACTGATGGCCCGGGAGACATGCAACTGTAGATCCTTGTGAGAAACCTTCCGGTA

Full Affymetrix probeset data:

Annotations for 1640887_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime