FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640889_at:

>probe:Drosophila_2:1640889_at:283:167; Interrogation_Position=397; Antisense; AAATGCTTATGTCTGCCACATGCGC
>probe:Drosophila_2:1640889_at:324:215; Interrogation_Position=446; Antisense; AAGATGTGGTACATCGCTGCCTTTG
>probe:Drosophila_2:1640889_at:257:337; Interrogation_Position=461; Antisense; GCTGCCTTTGTTCGCGGAATGTCCG
>probe:Drosophila_2:1640889_at:656:369; Interrogation_Position=477; Antisense; GAATGTCCGTCGACGAGGCGCTGAA
>probe:Drosophila_2:1640889_at:368:225; Interrogation_Position=542; Antisense; AAGGAGACCATACTGGAGGCCCAGC
>probe:Drosophila_2:1640889_at:370:543; Interrogation_Position=612; Antisense; GGATAGCCGAATCCTTCGTGGGCAA
>probe:Drosophila_2:1640889_at:691:637; Interrogation_Position=627; Antisense; TCGTGGGCAAGGGACGCGTCTTCAA
>probe:Drosophila_2:1640889_at:159:281; Interrogation_Position=669; Antisense; CTCGCGGTCGCTTCGGCAAAGTGGA
>probe:Drosophila_2:1640889_at:695:587; Interrogation_Position=690; Antisense; TGGAGTACAAGCACTGCCACTACTT
>probe:Drosophila_2:1640889_at:522:351; Interrogation_Position=742; Antisense; GCAGCACTACTACCAGGAGCCGCAG
>probe:Drosophila_2:1640889_at:217:375; Interrogation_Position=814; Antisense; GAAGATCATCAACTCGCTGTAGCCA
>probe:Drosophila_2:1640889_at:546:487; Interrogation_Position=832; Antisense; GTAGCCACCTGAATTGGCACTCGTA
>probe:Drosophila_2:1640889_at:516:567; Interrogation_Position=847; Antisense; GGCACTCGTATGCAATCGATCCGCA
>probe:Drosophila_2:1640889_at:423:291; Interrogation_Position=897; Antisense; CGTCCACGCGCATTAAGCATTTTTT

Paste this into a BLAST search page for me
AAATGCTTATGTCTGCCACATGCGCAAGATGTGGTACATCGCTGCCTTTGGCTGCCTTTGTTCGCGGAATGTCCGGAATGTCCGTCGACGAGGCGCTGAAAAGGAGACCATACTGGAGGCCCAGCGGATAGCCGAATCCTTCGTGGGCAATCGTGGGCAAGGGACGCGTCTTCAACTCGCGGTCGCTTCGGCAAAGTGGATGGAGTACAAGCACTGCCACTACTTGCAGCACTACTACCAGGAGCCGCAGGAAGATCATCAACTCGCTGTAGCCAGTAGCCACCTGAATTGGCACTCGTAGGCACTCGTATGCAATCGATCCGCACGTCCACGCGCATTAAGCATTTTTT

Full Affymetrix probeset data:

Annotations for 1640889_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720