FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640890_at:

>probe:Drosophila_2:1640890_at:112:355; Interrogation_Position=1000; Antisense; GCACTCCTTGTATATTCCTTCATTG
>probe:Drosophila_2:1640890_at:692:273; Interrogation_Position=1020; Antisense; CATTGTGCTTCATCTATTGCTAGTT
>probe:Drosophila_2:1640890_at:16:119; Interrogation_Position=538; Antisense; AGCTACAGCTTCAACTATGCCGTGA
>probe:Drosophila_2:1640890_at:500:611; Interrogation_Position=560; Antisense; TGAACGACGCGAGCACCGGTGACAT
>probe:Drosophila_2:1640890_at:334:653; Interrogation_Position=584; Antisense; TCAAGGAGCACAGCGAGACCCGGGA
>probe:Drosophila_2:1640890_at:699:591; Interrogation_Position=617; Antisense; TGGTGCGCGGATTCTACAGCCTGAT
>probe:Drosophila_2:1640890_at:702:141; Interrogation_Position=676; Antisense; ACGGCGGATGATGTGCATGGCTTCA
>probe:Drosophila_2:1640890_at:649:67; Interrogation_Position=692; Antisense; ATGGCTTCAATGCTGTGGTCAACCG
>probe:Drosophila_2:1640890_at:70:707; Interrogation_Position=731; Antisense; TTAAGGCGGTGGTTGTCCCTGTTGC
>probe:Drosophila_2:1640890_at:524:259; Interrogation_Position=771; Antisense; CACTCCATTTGTGGCTCGCGATGAG
>probe:Drosophila_2:1640890_at:721:123; Interrogation_Position=794; Antisense; AGCGCTCCAAGTCGGTGGATGTCAT
>probe:Drosophila_2:1640890_at:263:589; Interrogation_Position=809; Antisense; TGGATGTCATTCGATCGTCGGGAGC
>probe:Drosophila_2:1640890_at:626:647; Interrogation_Position=847; Antisense; TCAGAAAATGTCCTGTCCGGTTCCG
>probe:Drosophila_2:1640890_at:710:607; Interrogation_Position=921; Antisense; TGAGGACAGCTACGCCAATGCTCCG

Paste this into a BLAST search page for me
GCACTCCTTGTATATTCCTTCATTGCATTGTGCTTCATCTATTGCTAGTTAGCTACAGCTTCAACTATGCCGTGATGAACGACGCGAGCACCGGTGACATTCAAGGAGCACAGCGAGACCCGGGATGGTGCGCGGATTCTACAGCCTGATACGGCGGATGATGTGCATGGCTTCAATGGCTTCAATGCTGTGGTCAACCGTTAAGGCGGTGGTTGTCCCTGTTGCCACTCCATTTGTGGCTCGCGATGAGAGCGCTCCAAGTCGGTGGATGTCATTGGATGTCATTCGATCGTCGGGAGCTCAGAAAATGTCCTGTCCGGTTCCGTGAGGACAGCTACGCCAATGCTCCG

Full Affymetrix probeset data:

Annotations for 1640890_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720