FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640891_at:

>probe:Drosophila_2:1640891_at:151:21; Interrogation_Position=2953; Antisense; ATATTAACGCCAGTCCAGCATCATC
>probe:Drosophila_2:1640891_at:594:281; Interrogation_Position=3026; Antisense; CTCCTCGTCCAGAAGTAGCCATGGA
>probe:Drosophila_2:1640891_at:409:585; Interrogation_Position=3047; Antisense; TGGACATGGCCACAACTGCAACACA
>probe:Drosophila_2:1640891_at:395:539; Interrogation_Position=3157; Antisense; GGTACGAAGATGTGCCCATCGCCTA
>probe:Drosophila_2:1640891_at:623:133; Interrogation_Position=3184; Antisense; ACGAAAAGGTCATTGCCTTCCTGCG
>probe:Drosophila_2:1640891_at:716:629; Interrogation_Position=3220; Antisense; TCCTGGAGATCCTGCGAGAGCGCCA
>probe:Drosophila_2:1640891_at:639:415; Interrogation_Position=3237; Antisense; GAGCGCCAGGGCCAGCACACAATGT
>probe:Drosophila_2:1640891_at:43:229; Interrogation_Position=3257; Antisense; AATGTCCCGCCAGTTGCGTGAGAAA
>probe:Drosophila_2:1640891_at:162:529; Interrogation_Position=3303; Antisense; GGTGTTCCCGCACTCGAAAGATTGG
>probe:Drosophila_2:1640891_at:570:3; Interrogation_Position=3323; Antisense; ATTGGGCCATGACCTACAACTGACC
>probe:Drosophila_2:1640891_at:631:159; Interrogation_Position=3338; Antisense; ACAACTGACCATTTTGCTGAGGTGA
>probe:Drosophila_2:1640891_at:383:49; Interrogation_Position=3449; Antisense; ATCCAATTCTTGTTCTTTTGCTAAG
>probe:Drosophila_2:1640891_at:411:685; Interrogation_Position=3480; Antisense; TATACTCGAATTATTCCGCCAGCCA
>probe:Drosophila_2:1640891_at:725:687; Interrogation_Position=3491; Antisense; TATTCCGCCAGCCAGACAGTTGGAG

Paste this into a BLAST search page for me
ATATTAACGCCAGTCCAGCATCATCCTCCTCGTCCAGAAGTAGCCATGGATGGACATGGCCACAACTGCAACACAGGTACGAAGATGTGCCCATCGCCTAACGAAAAGGTCATTGCCTTCCTGCGTCCTGGAGATCCTGCGAGAGCGCCAGAGCGCCAGGGCCAGCACACAATGTAATGTCCCGCCAGTTGCGTGAGAAAGGTGTTCCCGCACTCGAAAGATTGGATTGGGCCATGACCTACAACTGACCACAACTGACCATTTTGCTGAGGTGAATCCAATTCTTGTTCTTTTGCTAAGTATACTCGAATTATTCCGCCAGCCATATTCCGCCAGCCAGACAGTTGGAG

Full Affymetrix probeset data:

Annotations for 1640891_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720