FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640894_at:

>probe:Drosophila_2:1640894_at:302:525; Interrogation_Position=1052; Antisense; GGGCAATCCTGGCTCTACATTGGTG
>probe:Drosophila_2:1640894_at:672:3; Interrogation_Position=1070; Antisense; ATTGGTGCCAAGACCCCAGAAGCAG
>probe:Drosophila_2:1640894_at:301:583; Interrogation_Position=1121; Antisense; TGGCAGGAATCTTCGTTGCTCGAGC
>probe:Drosophila_2:1640894_at:242:621; Interrogation_Position=1137; Antisense; TGCTCGAGCGCCTACGGATGTGTTA
>probe:Drosophila_2:1640894_at:373:545; Interrogation_Position=1216; Antisense; GGATCTGGTCGAGTTCCTGATGAAG
>probe:Drosophila_2:1640894_at:687:467; Interrogation_Position=1252; Antisense; GTTGTACATTTGTGCCGATGGCGCC
>probe:Drosophila_2:1640894_at:228:441; Interrogation_Position=1268; Antisense; GATGGCGCCAAGATTTCGCAGTCCA
>probe:Drosophila_2:1640894_at:441:695; Interrogation_Position=1281; Antisense; TTTCGCAGTCCATTGCAGGTGTTTT
>probe:Drosophila_2:1640894_at:15:267; Interrogation_Position=1296; Antisense; CAGGTGTTTTAAGTCGTTGCTTGCA
>probe:Drosophila_2:1640894_at:422:371; Interrogation_Position=1321; Antisense; GAAGGCTATGCATCTCACTGAAGAA
>probe:Drosophila_2:1640894_at:598:163; Interrogation_Position=1385; Antisense; AAATACCGCGAGGATGTTTGGCTGT
>probe:Drosophila_2:1640894_at:528:7; Interrogation_Position=965; Antisense; ATTGCTGTTGGCACAGGTCTGGCGC
>probe:Drosophila_2:1640894_at:477:581; Interrogation_Position=984; Antisense; TGGCGCCTTTTCTTGGATTCTTAGC
>probe:Drosophila_2:1640894_at:691:459; Interrogation_Position=999; Antisense; GATTCTTAGCCCACAAGGAAGAGCT

Paste this into a BLAST search page for me
GGGCAATCCTGGCTCTACATTGGTGATTGGTGCCAAGACCCCAGAAGCAGTGGCAGGAATCTTCGTTGCTCGAGCTGCTCGAGCGCCTACGGATGTGTTAGGATCTGGTCGAGTTCCTGATGAAGGTTGTACATTTGTGCCGATGGCGCCGATGGCGCCAAGATTTCGCAGTCCATTTCGCAGTCCATTGCAGGTGTTTTCAGGTGTTTTAAGTCGTTGCTTGCAGAAGGCTATGCATCTCACTGAAGAAAAATACCGCGAGGATGTTTGGCTGTATTGCTGTTGGCACAGGTCTGGCGCTGGCGCCTTTTCTTGGATTCTTAGCGATTCTTAGCCCACAAGGAAGAGCT

Full Affymetrix probeset data:

Annotations for 1640894_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720