FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640895_at:

>probe:Drosophila_2:1640895_at:89:211; Interrogation_Position=152; Antisense; AAGAACGACTCCAACTCGCAGCAAT
>probe:Drosophila_2:1640895_at:704:193; Interrogation_Position=164; Antisense; AACTCGCAGCAATCGGTGGATGGAA
>probe:Drosophila_2:1640895_at:526:547; Interrogation_Position=181; Antisense; GGATGGAATCGATGCGTTCGCCGCC
>probe:Drosophila_2:1640895_at:319:85; Interrogation_Position=317; Antisense; AGTGATCCGATCAGCTACCTGGCCA
>probe:Drosophila_2:1640895_at:362:581; Interrogation_Position=336; Antisense; TGGCCACCTATCTGCTGAAGAACAA
>probe:Drosophila_2:1640895_at:409:381; Interrogation_Position=361; Antisense; GAACCGCTGCGATGAGGTCAAGACA
>probe:Drosophila_2:1640895_at:317:177; Interrogation_Position=391; Antisense; AAACTAGTTACCCTTGGCTTGTGCT
>probe:Drosophila_2:1640895_at:653:595; Interrogation_Position=410; Antisense; TGTGCTCCCTTGTTTTAGTTTTTAT
>probe:Drosophila_2:1640895_at:212:697; Interrogation_Position=441; Antisense; TTTTGTCCCTTATCACGACGAACTG
>probe:Drosophila_2:1640895_at:631:23; Interrogation_Position=452; Antisense; ATCACGACGAACTGTTGCCGATTTT
>probe:Drosophila_2:1640895_at:345:319; Interrogation_Position=468; Antisense; GCCGATTTTAGGTTTCGCACACCAA
>probe:Drosophila_2:1640895_at:444:645; Interrogation_Position=500; Antisense; TCTTGTACACAACTTATCGCTGATT
>probe:Drosophila_2:1640895_at:598:635; Interrogation_Position=516; Antisense; TCGCTGATTACAACTGAAGGCCACT
>probe:Drosophila_2:1640895_at:690:183; Interrogation_Position=97; Antisense; AACAATGCCGGTTTCCCCTGGAGAG

Paste this into a BLAST search page for me
AAGAACGACTCCAACTCGCAGCAATAACTCGCAGCAATCGGTGGATGGAAGGATGGAATCGATGCGTTCGCCGCCAGTGATCCGATCAGCTACCTGGCCATGGCCACCTATCTGCTGAAGAACAAGAACCGCTGCGATGAGGTCAAGACAAAACTAGTTACCCTTGGCTTGTGCTTGTGCTCCCTTGTTTTAGTTTTTATTTTTGTCCCTTATCACGACGAACTGATCACGACGAACTGTTGCCGATTTTGCCGATTTTAGGTTTCGCACACCAATCTTGTACACAACTTATCGCTGATTTCGCTGATTACAACTGAAGGCCACTAACAATGCCGGTTTCCCCTGGAGAG

Full Affymetrix probeset data:

Annotations for 1640895_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720