Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640896_at:

>probe:Drosophila_2:1640896_at:207:545; Interrogation_Position=1313; Antisense; GGATCTTCACCAATGCGGACTCAAT
>probe:Drosophila_2:1640896_at:442:85; Interrogation_Position=1353; Antisense; AGTGAGCCTCTGGATGATCATCGCC
>probe:Drosophila_2:1640896_at:458:227; Interrogation_Position=1387; Antisense; AAGGCGGCTGTTTCGTGTGCCCAAT
>probe:Drosophila_2:1640896_at:429:597; Interrogation_Position=1402; Antisense; TGTGCCCAATCGATGATCCTGGCCT
>probe:Drosophila_2:1640896_at:436:631; Interrogation_Position=1418; Antisense; TCCTGGCCTGCATGAACGAACTGAT
>probe:Drosophila_2:1640896_at:342:211; Interrogation_Position=1453; Antisense; AAGAAGCAGCTTTTCGTCTTCTCCG
>probe:Drosophila_2:1640896_at:121:1; Interrogation_Position=1512; Antisense; GCCGTTCTTCAATGTCCTACGGAAG
>probe:Drosophila_2:1640896_at:206:279; Interrogation_Position=1528; Antisense; CTACGGAAGATCGACACTGCCATGT
>probe:Drosophila_2:1640896_at:715:269; Interrogation_Position=1548; Antisense; CATGTCGCTGACTTCGTATTGTGTA
>probe:Drosophila_2:1640896_at:370:305; Interrogation_Position=1616; Antisense; CCAGATTAAGTGTGTCCCCGGTAGT
>probe:Drosophila_2:1640896_at:690:485; Interrogation_Position=1636; Antisense; GTAGTGCCACACTTGGAGCAGAGAA
>probe:Drosophila_2:1640896_at:495:479; Interrogation_Position=1693; Antisense; GTTTGGACCGTCGAATCCGATGTGA
>probe:Drosophila_2:1640896_at:638:465; Interrogation_Position=1727; Antisense; GATTGTAGCCCAAGACGACAGCCTA
>probe:Drosophila_2:1640896_at:129:411; Interrogation_Position=1740; Antisense; GACGACAGCCTATTTTTGCCAATTA

Paste this into a BLAST search page for me
GGATCTTCACCAATGCGGACTCAATAGTGAGCCTCTGGATGATCATCGCCAAGGCGGCTGTTTCGTGTGCCCAATTGTGCCCAATCGATGATCCTGGCCTTCCTGGCCTGCATGAACGAACTGATAAGAAGCAGCTTTTCGTCTTCTCCGGCCGTTCTTCAATGTCCTACGGAAGCTACGGAAGATCGACACTGCCATGTCATGTCGCTGACTTCGTATTGTGTACCAGATTAAGTGTGTCCCCGGTAGTGTAGTGCCACACTTGGAGCAGAGAAGTTTGGACCGTCGAATCCGATGTGAGATTGTAGCCCAAGACGACAGCCTAGACGACAGCCTATTTTTGCCAATTA

Full Affymetrix probeset data:

Annotations for 1640896_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime