FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640897_at:

>probe:Drosophila_2:1640897_at:290:409; Interrogation_Position=1710; Antisense; GACCTGACCAATTTTACCGACGAAG
>probe:Drosophila_2:1640897_at:103:269; Interrogation_Position=1745; Antisense; CATGGAGGGCCTTCAACGTGATCAT
>probe:Drosophila_2:1640897_at:363:291; Interrogation_Position=1761; Antisense; CGTGATCATATTGTGCAGCGTCTAA
>probe:Drosophila_2:1640897_at:299:663; Interrogation_Position=1801; Antisense; TAAACCTAATGCTGGATTCCGCGGG
>probe:Drosophila_2:1640897_at:669:347; Interrogation_Position=1832; Antisense; GATGTCCCAGTACCAAAGTTTGTCT
>probe:Drosophila_2:1640897_at:247:331; Interrogation_Position=1893; Antisense; GCGGTCAACGGATCTGCTGATTCTA
>probe:Drosophila_2:1640897_at:269:335; Interrogation_Position=1908; Antisense; GCTGATTCTAGCGTCTACGACATGC
>probe:Drosophila_2:1640897_at:20:571; Interrogation_Position=1955; Antisense; GGCTCAGTTGGAGACTCACCAGGTT
>probe:Drosophila_2:1640897_at:39:59; Interrogation_Position=2068; Antisense; ATGATATACCATCGACGGCCACGGA
>probe:Drosophila_2:1640897_at:443:141; Interrogation_Position=2088; Antisense; ACGGAGGCAGTTAGCATTCCCAACT
>probe:Drosophila_2:1640897_at:73:375; Interrogation_Position=2159; Antisense; GAAGCGCCGTTTGAAGTTCCTTGAA
>probe:Drosophila_2:1640897_at:592:417; Interrogation_Position=2184; Antisense; GAGCGGAACAAGTCTGCAGCCACTA
>probe:Drosophila_2:1640897_at:576:353; Interrogation_Position=2199; Antisense; GCAGCCACTAATGAACGCACGACAG
>probe:Drosophila_2:1640897_at:188:365; Interrogation_Position=2226; Antisense; GAATAGACGCCCTACAATCTGATGT

Paste this into a BLAST search page for me
GACCTGACCAATTTTACCGACGAAGCATGGAGGGCCTTCAACGTGATCATCGTGATCATATTGTGCAGCGTCTAATAAACCTAATGCTGGATTCCGCGGGGATGTCCCAGTACCAAAGTTTGTCTGCGGTCAACGGATCTGCTGATTCTAGCTGATTCTAGCGTCTACGACATGCGGCTCAGTTGGAGACTCACCAGGTTATGATATACCATCGACGGCCACGGAACGGAGGCAGTTAGCATTCCCAACTGAAGCGCCGTTTGAAGTTCCTTGAAGAGCGGAACAAGTCTGCAGCCACTAGCAGCCACTAATGAACGCACGACAGGAATAGACGCCCTACAATCTGATGT

Full Affymetrix probeset data:

Annotations for 1640897_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720