FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640898_at:

>probe:Drosophila_2:1640898_at:264:725; Interrogation_Position=1014; Antisense; TTGTGTGGGCGACATCAACCGGCAA
>probe:Drosophila_2:1640898_at:26:647; Interrogation_Position=1044; Antisense; TCAGTTGCATCGTGGTGGTGGAACC
>probe:Drosophila_2:1640898_at:322:517; Interrogation_Position=1069; Antisense; GTGTGCCACAAGAGCGCCAGGGTAT
>probe:Drosophila_2:1640898_at:679:79; Interrogation_Position=1087; Antisense; AGGGTATCCAATCTGTACCGCCAAC
>probe:Drosophila_2:1640898_at:98:193; Interrogation_Position=1120; Antisense; AACTACGACAAGTGCGCCCAACAGG
>probe:Drosophila_2:1640898_at:443:421; Interrogation_Position=674; Antisense; GGCGGACGGAATCACCGTTCCAGAA
>probe:Drosophila_2:1640898_at:591:407; Interrogation_Position=721; Antisense; GACGGCAAGAAGTTCCGGCTGTTTG
>probe:Drosophila_2:1640898_at:333:585; Interrogation_Position=753; Antisense; TGGACGCGCCAATGTGGAGCTGTAC
>probe:Drosophila_2:1640898_at:95:419; Interrogation_Position=769; Antisense; GAGCTGTACGCCGATGTGGTCGCAC
>probe:Drosophila_2:1640898_at:301:133; Interrogation_Position=792; Antisense; ACCCACTCTGGATGTCAGTCTTTTT
>probe:Drosophila_2:1640898_at:572:359; Interrogation_Position=842; Antisense; GCAACTTACCGAATAGCTGCGATAA
>probe:Drosophila_2:1640898_at:528:201; Interrogation_Position=901; Antisense; AATCCGGAGCTATCGGTGGACTTTA
>probe:Drosophila_2:1640898_at:216:483; Interrogation_Position=955; Antisense; GTATCTCGTCCCACAGGCATTTTGA
>probe:Drosophila_2:1640898_at:438:569; Interrogation_Position=970; Antisense; GGCATTTTGATCTACCATTGGCGAG

Paste this into a BLAST search page for me
TTGTGTGGGCGACATCAACCGGCAATCAGTTGCATCGTGGTGGTGGAACCGTGTGCCACAAGAGCGCCAGGGTATAGGGTATCCAATCTGTACCGCCAACAACTACGACAAGTGCGCCCAACAGGGGCGGACGGAATCACCGTTCCAGAAGACGGCAAGAAGTTCCGGCTGTTTGTGGACGCGCCAATGTGGAGCTGTACGAGCTGTACGCCGATGTGGTCGCACACCCACTCTGGATGTCAGTCTTTTTGCAACTTACCGAATAGCTGCGATAAAATCCGGAGCTATCGGTGGACTTTAGTATCTCGTCCCACAGGCATTTTGAGGCATTTTGATCTACCATTGGCGAG

Full Affymetrix probeset data:

Annotations for 1640898_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720