Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640900_at:

>probe:Drosophila_2:1640900_at:389:215; Interrogation_Position=1058; Antisense; AAGATCGCGGACATGTCGTTGGCCA
>probe:Drosophila_2:1640900_at:560:597; Interrogation_Position=1194; Antisense; TGTGCTCCCACCAGTGTATCCAGAT
>probe:Drosophila_2:1640900_at:98:229; Interrogation_Position=1228; Antisense; AATGGGCTACGTGACCGACATGGCG
>probe:Drosophila_2:1640900_at:437:151; Interrogation_Position=1245; Antisense; ACATGGCGGCCGAGCGTCATTACAG
>probe:Drosophila_2:1640900_at:57:609; Interrogation_Position=1285; Antisense; TGAGATCTACGAGGGCACCTCCGAA
>probe:Drosophila_2:1640900_at:22:451; Interrogation_Position=1324; Antisense; GATCGCGGGCTCCATTCTAAAGGAA
>probe:Drosophila_2:1640900_at:292:629; Interrogation_Position=1376; Antisense; TCCGTACTACTTGTGTCTCGTTTAA
>probe:Drosophila_2:1640900_at:194:545; Interrogation_Position=824; Antisense; GGATCTTCGACGTGCCAGCTAATTT
>probe:Drosophila_2:1640900_at:467:245; Interrogation_Position=844; Antisense; AATTTTCGAGGACTGCGTGGTGCCC
>probe:Drosophila_2:1640900_at:714:321; Interrogation_Position=885; Antisense; GCGAGCCGGGTTTCGGTTTCAAGAT
>probe:Drosophila_2:1640900_at:572:95; Interrogation_Position=906; Antisense; AGATTGCCATGCAGACGCTGGACGC
>probe:Drosophila_2:1640900_at:355:411; Interrogation_Position=926; Antisense; GACGCCGGCCGCATAGGAATCGCTG
>probe:Drosophila_2:1640900_at:651:1; Interrogation_Position=965; Antisense; ATTGGTCAGGCTGCCCTCGAATTGG
>probe:Drosophila_2:1640900_at:637:247; Interrogation_Position=984; Antisense; AATTGGCCGTGGACTACGCCCAGAA

Paste this into a BLAST search page for me
AAGATCGCGGACATGTCGTTGGCCATGTGCTCCCACCAGTGTATCCAGATAATGGGCTACGTGACCGACATGGCGACATGGCGGCCGAGCGTCATTACAGTGAGATCTACGAGGGCACCTCCGAAGATCGCGGGCTCCATTCTAAAGGAATCCGTACTACTTGTGTCTCGTTTAAGGATCTTCGACGTGCCAGCTAATTTAATTTTCGAGGACTGCGTGGTGCCCGCGAGCCGGGTTTCGGTTTCAAGATAGATTGCCATGCAGACGCTGGACGCGACGCCGGCCGCATAGGAATCGCTGATTGGTCAGGCTGCCCTCGAATTGGAATTGGCCGTGGACTACGCCCAGAA

Full Affymetrix probeset data:

Annotations for 1640900_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime