FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640901_at:

>probe:Drosophila_2:1640901_at:309:79; Interrogation_Position=1209; Antisense; AGGTCATTGGTCCAGTGCTTGGCAC
>probe:Drosophila_2:1640901_at:675:343; Interrogation_Position=1225; Antisense; GCTTGGCACACGGAACTATGTCTCT
>probe:Drosophila_2:1640901_at:249:83; Interrogation_Position=1260; Antisense; AGGGCGTCGAGATGTTCTCCACGAA
>probe:Drosophila_2:1640901_at:594:373; Interrogation_Position=1297; Antisense; GAAGTTCCTATCGATGACGTGTCTG
>probe:Drosophila_2:1640901_at:435:183; Interrogation_Position=1329; Antisense; AAAAGCCACTGGTCTGCATCAGTCG
>probe:Drosophila_2:1640901_at:174:55; Interrogation_Position=1374; Antisense; ATGACACCCGATTCCTTAACAAGAC
>probe:Drosophila_2:1640901_at:110:661; Interrogation_Position=1390; Antisense; TAACAAGACGTTATTGCCCGACCTG
>probe:Drosophila_2:1640901_at:257:607; Interrogation_Position=1452; Antisense; TGATGCACTACTTCCAGGGCTATGT
>probe:Drosophila_2:1640901_at:73:599; Interrogation_Position=1476; Antisense; TGTCCACCAGATTCCGGCAGTATGA
>probe:Drosophila_2:1640901_at:311:91; Interrogation_Position=1494; Antisense; AGTATGACTACGGTCCCGAGCGGAA
>probe:Drosophila_2:1640901_at:199:183; Interrogation_Position=1599; Antisense; AAAACGACTACATTGTGGCGCCGGC
>probe:Drosophila_2:1640901_at:592:379; Interrogation_Position=1661; Antisense; GAAGCCGTGTACAAGGTTCCCTGGA
>probe:Drosophila_2:1640901_at:524:67; Interrogation_Position=1690; Antisense; ATGGAACCACTTTGACTTCATCTGC
>probe:Drosophila_2:1640901_at:446:191; Interrogation_Position=1745; Antisense; AACATTGTGCTTTCCATGAACCGCT

Paste this into a BLAST search page for me
AGGTCATTGGTCCAGTGCTTGGCACGCTTGGCACACGGAACTATGTCTCTAGGGCGTCGAGATGTTCTCCACGAAGAAGTTCCTATCGATGACGTGTCTGAAAAGCCACTGGTCTGCATCAGTCGATGACACCCGATTCCTTAACAAGACTAACAAGACGTTATTGCCCGACCTGTGATGCACTACTTCCAGGGCTATGTTGTCCACCAGATTCCGGCAGTATGAAGTATGACTACGGTCCCGAGCGGAAAAAACGACTACATTGTGGCGCCGGCGAAGCCGTGTACAAGGTTCCCTGGAATGGAACCACTTTGACTTCATCTGCAACATTGTGCTTTCCATGAACCGCT

Full Affymetrix probeset data:

Annotations for 1640901_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720