FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640903_at:

>probe:Drosophila_2:1640903_at:393:553; Interrogation_Position=239; Antisense; GGAGCAGCCGCGACCCAATGAGTTG
>probe:Drosophila_2:1640903_at:120:657; Interrogation_Position=332; Antisense; TAAGATCACAGCCAATCATCTGGGC
>probe:Drosophila_2:1640903_at:407:343; Interrogation_Position=364; Antisense; GCTTCCACATCTGCGATTTGGACGA
>probe:Drosophila_2:1640903_at:560:311; Interrogation_Position=397; Antisense; GCGAGTCGGAGGATTGCTTTAACCA
>probe:Drosophila_2:1640903_at:721:711; Interrogation_Position=435; Antisense; TTCACCGACGGTAGCCAGAAGTACT
>probe:Drosophila_2:1640903_at:73:91; Interrogation_Position=454; Antisense; AGTACTACATTAACACCACCACTGG
>probe:Drosophila_2:1640903_at:516:573; Interrogation_Position=477; Antisense; GGCGATATCCCAGTAACCGTGAAAC
>probe:Drosophila_2:1640903_at:239:85; Interrogation_Position=507; Antisense; AGTGATCTCAACTGCATTCATTGCG
>probe:Drosophila_2:1640903_at:586:11; Interrogation_Position=522; Antisense; ATTCATTGCGTTTTGCGCTGGACTT
>probe:Drosophila_2:1640903_at:662:331; Interrogation_Position=538; Antisense; GCTGGACTTACACGGCGGGAAATAA
>probe:Drosophila_2:1640903_at:232:559; Interrogation_Position=611; Antisense; GGAAACCTTTATTAACTGCGCTGAT
>probe:Drosophila_2:1640903_at:648:35; Interrogation_Position=636; Antisense; ATCAGTGTACTATCCTCAGCGAGAA
>probe:Drosophila_2:1640903_at:470:519; Interrogation_Position=706; Antisense; GTGGTTATCATCAGCGGTGGCCAAT
>probe:Drosophila_2:1640903_at:157:533; Interrogation_Position=721; Antisense; GGTGGCCAATCGAACAATACTGCTA

Paste this into a BLAST search page for me
GGAGCAGCCGCGACCCAATGAGTTGTAAGATCACAGCCAATCATCTGGGCGCTTCCACATCTGCGATTTGGACGAGCGAGTCGGAGGATTGCTTTAACCATTCACCGACGGTAGCCAGAAGTACTAGTACTACATTAACACCACCACTGGGGCGATATCCCAGTAACCGTGAAACAGTGATCTCAACTGCATTCATTGCGATTCATTGCGTTTTGCGCTGGACTTGCTGGACTTACACGGCGGGAAATAAGGAAACCTTTATTAACTGCGCTGATATCAGTGTACTATCCTCAGCGAGAAGTGGTTATCATCAGCGGTGGCCAATGGTGGCCAATCGAACAATACTGCTA

Full Affymetrix probeset data:

Annotations for 1640903_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720