FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640905_at:

>probe:Drosophila_2:1640905_at:10:581; Interrogation_Position=436; Antisense; TGGCAGCCGGGACATCAACTCGATA
>probe:Drosophila_2:1640905_at:586:545; Interrogation_Position=472; Antisense; GGAGGACACCCTGAAACTGGACGCC
>probe:Drosophila_2:1640905_at:609:515; Interrogation_Position=506; Antisense; GTGGTGGACCCTGCCAAGCAGTTGA
>probe:Drosophila_2:1640905_at:42:49; Interrogation_Position=578; Antisense; ATCCAGGCCGGCGAGCAGAAGAAGC
>probe:Drosophila_2:1640905_at:675:109; Interrogation_Position=633; Antisense; AGAAGTCAGAGATCCTGCGCCAGAT
>probe:Drosophila_2:1640905_at:61:225; Interrogation_Position=659; Antisense; AAGGACTTGGAGAGCACGCCGCGCT
>probe:Drosophila_2:1640905_at:44:267; Interrogation_Position=711; Antisense; CAGTCCACTCAGATACTGCTACGAG
>probe:Drosophila_2:1640905_at:606:669; Interrogation_Position=724; Antisense; TACTGCTACGAGTATATCCTCTCAC
>probe:Drosophila_2:1640905_at:27:25; Interrogation_Position=737; Antisense; ATATCCTCTCACCTCGTGAACAAAT
>probe:Drosophila_2:1640905_at:534:319; Interrogation_Position=779; Antisense; GCCGCCTCTGCACGAAAGAACACAT
>probe:Drosophila_2:1640905_at:615:385; Interrogation_Position=796; Antisense; GAACACATACATGCCTATGTCTGTT
>probe:Drosophila_2:1640905_at:355:475; Interrogation_Position=835; Antisense; GTTTTAGTCGAAGATGTCAAGCCAT
>probe:Drosophila_2:1640905_at:349:229; Interrogation_Position=884; Antisense; AATGTGTGTCTGTCTTGAAACCTAG
>probe:Drosophila_2:1640905_at:218:565; Interrogation_Position=922; Antisense; GGAATCGCCGCGTTTATTTATGTAT

Paste this into a BLAST search page for me
TGGCAGCCGGGACATCAACTCGATAGGAGGACACCCTGAAACTGGACGCCGTGGTGGACCCTGCCAAGCAGTTGAATCCAGGCCGGCGAGCAGAAGAAGCAGAAGTCAGAGATCCTGCGCCAGATAAGGACTTGGAGAGCACGCCGCGCTCAGTCCACTCAGATACTGCTACGAGTACTGCTACGAGTATATCCTCTCACATATCCTCTCACCTCGTGAACAAATGCCGCCTCTGCACGAAAGAACACATGAACACATACATGCCTATGTCTGTTGTTTTAGTCGAAGATGTCAAGCCATAATGTGTGTCTGTCTTGAAACCTAGGGAATCGCCGCGTTTATTTATGTAT

Full Affymetrix probeset data:

Annotations for 1640905_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720