FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640906_at:

>probe:Drosophila_2:1640906_at:149:33; Interrogation_Position=208; Antisense; ATAATCTCGGCCACTCACGTAATCA
>probe:Drosophila_2:1640906_at:563:493; Interrogation_Position=226; Antisense; GTAATCACCGCTGGCCACTGTGTGA
>probe:Drosophila_2:1640906_at:3:487; Interrogation_Position=265; Antisense; GTAGTTCCGGCAGATCTATGGTCAA
>probe:Drosophila_2:1640906_at:92:645; Interrogation_Position=279; Antisense; TCTATGGTCAATCCAGGCGGGCAGT
>probe:Drosophila_2:1640906_at:208:83; Interrogation_Position=336; Antisense; AGTGGCCGAAGTTATCATGCATCCC
>probe:Drosophila_2:1640906_at:419:53; Interrogation_Position=352; Antisense; ATGCATCCCAACTATGCCACTGGTG
>probe:Drosophila_2:1640906_at:523:519; Interrogation_Position=374; Antisense; GTGGACACAACGATTTGGCCGTGCT
>probe:Drosophila_2:1640906_at:418:523; Interrogation_Position=569; Antisense; GGGCCTGTCGCTGGATGTTCTACTC
>probe:Drosophila_2:1640906_at:116:57; Interrogation_Position=583; Antisense; ATGTTCTACTCTCGTTTGCCAGAAA
>probe:Drosophila_2:1640906_at:406:107; Interrogation_Position=603; Antisense; AGAAACCATGATTTGCCTGCTGCAT
>probe:Drosophila_2:1640906_at:651:273; Interrogation_Position=625; Antisense; CATTCCAAGAATAGCGGCGCCTGTT
>probe:Drosophila_2:1640906_at:251:709; Interrogation_Position=706; Antisense; TTACTCCTCGGTGGTGGCTGTGGAA
>probe:Drosophila_2:1640906_at:132:375; Interrogation_Position=728; Antisense; GAAGAGCGGCTCCTGATGGCTACCT
>probe:Drosophila_2:1640906_at:588:439; Interrogation_Position=742; Antisense; GATGGCTACCTTAGGATCTCCAAGG

Paste this into a BLAST search page for me
ATAATCTCGGCCACTCACGTAATCAGTAATCACCGCTGGCCACTGTGTGAGTAGTTCCGGCAGATCTATGGTCAATCTATGGTCAATCCAGGCGGGCAGTAGTGGCCGAAGTTATCATGCATCCCATGCATCCCAACTATGCCACTGGTGGTGGACACAACGATTTGGCCGTGCTGGGCCTGTCGCTGGATGTTCTACTCATGTTCTACTCTCGTTTGCCAGAAAAGAAACCATGATTTGCCTGCTGCATCATTCCAAGAATAGCGGCGCCTGTTTTACTCCTCGGTGGTGGCTGTGGAAGAAGAGCGGCTCCTGATGGCTACCTGATGGCTACCTTAGGATCTCCAAGG

Full Affymetrix probeset data:

Annotations for 1640906_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720