Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640907_at:

>probe:Drosophila_2:1640907_at:240:81; Interrogation_Position=1015; Antisense; AGGGAGCCACCTATGACGAAATCAA
>probe:Drosophila_2:1640907_at:231:413; Interrogation_Position=1050; Antisense; GAGGAGGCCTCCAAGGGACCCCTGA
>probe:Drosophila_2:1640907_at:613:55; Interrogation_Position=1096; Antisense; ATGAGGAGGTGGTCTCCACCGACTT
>probe:Drosophila_2:1640907_at:356:711; Interrogation_Position=1122; Antisense; TTCAGCGACACCCATTCGTCTGTGT
>probe:Drosophila_2:1640907_at:475:11; Interrogation_Position=1135; Antisense; ATTCGTCTGTGTTCGACGCCAAGGC
>probe:Drosophila_2:1640907_at:363:471; Interrogation_Position=1181; Antisense; GTTCGTCAAGCTAATCTCGTGGTAC
>probe:Drosophila_2:1640907_at:26:121; Interrogation_Position=1308; Antisense; AGCTGGTCGGGAATCACTGTTGCAT
>probe:Drosophila_2:1640907_at:238:35; Interrogation_Position=1320; Antisense; ATCACTGTTGCATAATCCGCAAGGG
>probe:Drosophila_2:1640907_at:175:467; Interrogation_Position=1414; Antisense; GTTGTTGAATAAAGTATCGCCCTGT
>probe:Drosophila_2:1640907_at:104:485; Interrogation_Position=1427; Antisense; GTATCGCCCTGTTACTGTATTTAAA
>probe:Drosophila_2:1640907_at:529:301; Interrogation_Position=901; Antisense; CCGCCAAGGCTGTGGGCAAGGTCAT
>probe:Drosophila_2:1640907_at:453:197; Interrogation_Position=936; Antisense; AACGGCAAGCTGACCGGCATGGCTT
>probe:Drosophila_2:1640907_at:419:229; Interrogation_Position=978; Antisense; AATGTCTCCGTTGTGGATCTTACCG
>probe:Drosophila_2:1640907_at:261:639; Interrogation_Position=995; Antisense; TCTTACCGTCCGCTTGGGCAAGGGA

Paste this into a BLAST search page for me
AGGGAGCCACCTATGACGAAATCAAGAGGAGGCCTCCAAGGGACCCCTGAATGAGGAGGTGGTCTCCACCGACTTTTCAGCGACACCCATTCGTCTGTGTATTCGTCTGTGTTCGACGCCAAGGCGTTCGTCAAGCTAATCTCGTGGTACAGCTGGTCGGGAATCACTGTTGCATATCACTGTTGCATAATCCGCAAGGGGTTGTTGAATAAAGTATCGCCCTGTGTATCGCCCTGTTACTGTATTTAAACCGCCAAGGCTGTGGGCAAGGTCATAACGGCAAGCTGACCGGCATGGCTTAATGTCTCCGTTGTGGATCTTACCGTCTTACCGTCCGCTTGGGCAAGGGA

Full Affymetrix probeset data:

Annotations for 1640907_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime