FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640908_at:

>probe:Drosophila_2:1640908_at:516:663; Interrogation_Position=113; Antisense; TAAAGATGGTCAAGGGCTTGGGTCC
>probe:Drosophila_2:1640908_at:142:631; Interrogation_Position=135; Antisense; TCCGGGTTCGGTTTTGGCTGCAGTT
>probe:Drosophila_2:1640908_at:596:727; Interrogation_Position=148; Antisense; TTGGCTGCAGTTTGGTCTCGGGTTT
>probe:Drosophila_2:1640908_at:488:571; Interrogation_Position=175; Antisense; GGCTCTGGTGTTGGTTTGGCAAATT
>probe:Drosophila_2:1640908_at:501:479; Interrogation_Position=188; Antisense; GTTTGGCAAATTTTTACAGCGCTTT
>probe:Drosophila_2:1640908_at:146:321; Interrogation_Position=206; Antisense; GCGCTTTTATAAACAGCCCCGTTGT
>probe:Drosophila_2:1640908_at:648:141; Interrogation_Position=248; Antisense; ACTGGGCGTGTACTCCCCTCGGGAT
>probe:Drosophila_2:1640908_at:206:633; Interrogation_Position=261; Antisense; TCCCCTCGGGATGAGCATGATCGTG
>probe:Drosophila_2:1640908_at:393:451; Interrogation_Position=279; Antisense; GATCGTGAAGATCAGCTCCCAAGCA
>probe:Drosophila_2:1640908_at:389:209; Interrogation_Position=299; Antisense; AAGCAGCTCCCTCTTTGGCTGGCGA
>probe:Drosophila_2:1640908_at:118:583; Interrogation_Position=314; Antisense; TGGCTGGCGACTCGAGCACTTGCTT
>probe:Drosophila_2:1640908_at:480:605; Interrogation_Position=334; Antisense; TGCTTCCTCGACACAAATCAACGGG
>probe:Drosophila_2:1640908_at:721:133; Interrogation_Position=38; Antisense; ACGCAAAGGCTAAGGCGATGGTGCT
>probe:Drosophila_2:1640908_at:337:641; Interrogation_Position=99; Antisense; TCTGGAGCTGATGCTAAAGATGGTC

Paste this into a BLAST search page for me
TAAAGATGGTCAAGGGCTTGGGTCCTCCGGGTTCGGTTTTGGCTGCAGTTTTGGCTGCAGTTTGGTCTCGGGTTTGGCTCTGGTGTTGGTTTGGCAAATTGTTTGGCAAATTTTTACAGCGCTTTGCGCTTTTATAAACAGCCCCGTTGTACTGGGCGTGTACTCCCCTCGGGATTCCCCTCGGGATGAGCATGATCGTGGATCGTGAAGATCAGCTCCCAAGCAAAGCAGCTCCCTCTTTGGCTGGCGATGGCTGGCGACTCGAGCACTTGCTTTGCTTCCTCGACACAAATCAACGGGACGCAAAGGCTAAGGCGATGGTGCTTCTGGAGCTGATGCTAAAGATGGTC

Full Affymetrix probeset data:

Annotations for 1640908_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720