Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640909_at:

>probe:Drosophila_2:1640909_at:591:67; Interrogation_Position=4629; Antisense; ATGGCACATTGTGACCACGATCGAC
>probe:Drosophila_2:1640909_at:139:451; Interrogation_Position=4647; Antisense; GATCGACCTCCAAGGTACAGGCCTC
>probe:Drosophila_2:1640909_at:196:315; Interrogation_Position=4667; Antisense; GCCTCCCTGTACATGATTCTGTTTA
>probe:Drosophila_2:1640909_at:257:363; Interrogation_Position=4709; Antisense; GCAATTCTGCAAACGATGGCCACAC
>probe:Drosophila_2:1640909_at:326:157; Interrogation_Position=4730; Antisense; ACACCGCCGTTGCTTCGTTGGCGAT
>probe:Drosophila_2:1640909_at:538:727; Interrogation_Position=4747; Antisense; TTGGCGATCGCCTTTACTTACAGTT
>probe:Drosophila_2:1640909_at:649:145; Interrogation_Position=4762; Antisense; ACTTACAGTTTCTGGACCGGATCTG
>probe:Drosophila_2:1640909_at:69:661; Interrogation_Position=4823; Antisense; TAACAACCACACGATGGCACCGAAT
>probe:Drosophila_2:1640909_at:419:81; Interrogation_Position=4874; Antisense; AGGTGGCGCCGATGCGAATTTGAAT
>probe:Drosophila_2:1640909_at:707:495; Interrogation_Position=4906; Antisense; GTCAGTCGGGCATATGGCTAGCAAA
>probe:Drosophila_2:1640909_at:92:473; Interrogation_Position=5014; Antisense; GTTATCAATTTGTAGGGCCAGCTTT
>probe:Drosophila_2:1640909_at:343:523; Interrogation_Position=5028; Antisense; GGGCCAGCTTTCTTATTGGATTACA
>probe:Drosophila_2:1640909_at:15:543; Interrogation_Position=5045; Antisense; GGATTACATTTACCTTTCAATCTGT
>probe:Drosophila_2:1640909_at:235:207; Interrogation_Position=5107; Antisense; AAGCTTGTCCTTACACTTATACTTA

Paste this into a BLAST search page for me
ATGGCACATTGTGACCACGATCGACGATCGACCTCCAAGGTACAGGCCTCGCCTCCCTGTACATGATTCTGTTTAGCAATTCTGCAAACGATGGCCACACACACCGCCGTTGCTTCGTTGGCGATTTGGCGATCGCCTTTACTTACAGTTACTTACAGTTTCTGGACCGGATCTGTAACAACCACACGATGGCACCGAATAGGTGGCGCCGATGCGAATTTGAATGTCAGTCGGGCATATGGCTAGCAAAGTTATCAATTTGTAGGGCCAGCTTTGGGCCAGCTTTCTTATTGGATTACAGGATTACATTTACCTTTCAATCTGTAAGCTTGTCCTTACACTTATACTTA

Full Affymetrix probeset data:

Annotations for 1640909_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime