FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640910_at:

>probe:Drosophila_2:1640910_at:642:267; Interrogation_Position=1023; Antisense; CATCCTCCAGCTGGAAGTGATTCCA
>probe:Drosophila_2:1640910_at:7:515; Interrogation_Position=1039; Antisense; GTGATTCCATGCCATTCGATTCGAG
>probe:Drosophila_2:1640910_at:586:463; Interrogation_Position=1056; Antisense; GATTCGAGTCATACTGATCCTTGAG
>probe:Drosophila_2:1640910_at:295:691; Interrogation_Position=1134; Antisense; TATTGTTGTTCCCATTTTACCTCAC
>probe:Drosophila_2:1640910_at:145:105; Interrogation_Position=606; Antisense; AGACTGTGAAGGTCATCCATCAGGA
>probe:Drosophila_2:1640910_at:591:47; Interrogation_Position=620; Antisense; ATCCATCAGGAGGTTGGCGGTCATG
>probe:Drosophila_2:1640910_at:637:705; Interrogation_Position=649; Antisense; TTACTCTGGCGGACATGGTGGCTAC
>probe:Drosophila_2:1640910_at:446:77; Interrogation_Position=693; Antisense; AGGTCAAGACCGTTAAGGTCATCCA
>probe:Drosophila_2:1640910_at:613:495; Interrogation_Position=710; Antisense; GTCATCCACGAGGAAGGACACGCTT
>probe:Drosophila_2:1640910_at:716:75; Interrogation_Position=828; Antisense; AGGAGGGCGGTCACAGCCACGATCA
>probe:Drosophila_2:1640910_at:178:455; Interrogation_Position=848; Antisense; GATCACGGTCATTCGCACGGCGGAT
>probe:Drosophila_2:1640910_at:466:297; Interrogation_Position=861; Antisense; CGCACGGCGGATTCGAAGAGGTCAA
>probe:Drosophila_2:1640910_at:550:537; Interrogation_Position=895; Antisense; GGTCATTCACGAGGACGGTGGCCAT
>probe:Drosophila_2:1640910_at:543:27; Interrogation_Position=958; Antisense; ATACCTGCCGCCCAGCAATGAGTAT

Paste this into a BLAST search page for me
CATCCTCCAGCTGGAAGTGATTCCAGTGATTCCATGCCATTCGATTCGAGGATTCGAGTCATACTGATCCTTGAGTATTGTTGTTCCCATTTTACCTCACAGACTGTGAAGGTCATCCATCAGGAATCCATCAGGAGGTTGGCGGTCATGTTACTCTGGCGGACATGGTGGCTACAGGTCAAGACCGTTAAGGTCATCCAGTCATCCACGAGGAAGGACACGCTTAGGAGGGCGGTCACAGCCACGATCAGATCACGGTCATTCGCACGGCGGATCGCACGGCGGATTCGAAGAGGTCAAGGTCATTCACGAGGACGGTGGCCATATACCTGCCGCCCAGCAATGAGTAT

Full Affymetrix probeset data:

Annotations for 1640910_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720