FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640913_at:

>probe:Drosophila_2:1640913_at:100:497; Interrogation_Position=2185; Antisense; GTCATCTCGCGCAACTATTGGGTGT
>probe:Drosophila_2:1640913_at:574:531; Interrogation_Position=2204; Antisense; GGGTGTGCATCAAAAGCCGCGATCC
>probe:Drosophila_2:1640913_at:79:321; Interrogation_Position=2219; Antisense; GCCGCGATCCGGACATCAATTGCAA
>probe:Drosophila_2:1640913_at:414:169; Interrogation_Position=2268; Antisense; AAAGGATGGCTCTATTCGTGTGCTC
>probe:Drosophila_2:1640913_at:668:515; Interrogation_Position=2285; Antisense; GTGTGCTCCGTGTTTACAACAGTCA
>probe:Drosophila_2:1640913_at:378:27; Interrogation_Position=2309; Antisense; ATAGCCATCCTTTCAGCGAGGACGA
>probe:Drosophila_2:1640913_at:621:555; Interrogation_Position=2328; Antisense; GGACGACATCAAGCGGAGACTCTAC
>probe:Drosophila_2:1640913_at:332:107; Interrogation_Position=2378; Antisense; AGAACCTAAAGTTTCGGCCGCTGCA
>probe:Drosophila_2:1640913_at:714:43; Interrogation_Position=2455; Antisense; ATCGAGCGCCTGAATGTGTCTAATA
>probe:Drosophila_2:1640913_at:506:35; Interrogation_Position=2479; Antisense; ATCAGCAGCGACATTGTGGTTCACA
>probe:Drosophila_2:1640913_at:592:517; Interrogation_Position=2494; Antisense; GTGGTTCACAAGAAGCCTCGAGTTA
>probe:Drosophila_2:1640913_at:434:351; Interrogation_Position=2534; Antisense; GCAGATCTGCATCATTATCCGTGTC
>probe:Drosophila_2:1640913_at:526:265; Interrogation_Position=2562; Antisense; CAGAGCGGACTCTCACCATGAGGAA
>probe:Drosophila_2:1640913_at:366:393; Interrogation_Position=2728; Antisense; GAAAGCTACGGCTCTATTGTGTATG

Paste this into a BLAST search page for me
GTCATCTCGCGCAACTATTGGGTGTGGGTGTGCATCAAAAGCCGCGATCCGCCGCGATCCGGACATCAATTGCAAAAAGGATGGCTCTATTCGTGTGCTCGTGTGCTCCGTGTTTACAACAGTCAATAGCCATCCTTTCAGCGAGGACGAGGACGACATCAAGCGGAGACTCTACAGAACCTAAAGTTTCGGCCGCTGCAATCGAGCGCCTGAATGTGTCTAATAATCAGCAGCGACATTGTGGTTCACAGTGGTTCACAAGAAGCCTCGAGTTAGCAGATCTGCATCATTATCCGTGTCCAGAGCGGACTCTCACCATGAGGAAGAAAGCTACGGCTCTATTGTGTATG

Full Affymetrix probeset data:

Annotations for 1640913_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720