FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640914_at:

>probe:Drosophila_2:1640914_at:632:211; Interrogation_Position=412; Antisense; AAGACCAAGACCGTGTCGCCAAGGC
>probe:Drosophila_2:1640914_at:628:71; Interrogation_Position=433; Antisense; AGGCACTCCCTGTCCAGCAAGAAGA
>probe:Drosophila_2:1640914_at:673:209; Interrogation_Position=451; Antisense; AAGAAGACCAGTGCCAATTCCTCCA
>probe:Drosophila_2:1640914_at:569:535; Interrogation_Position=480; Antisense; GGTCGTCATTCAGCCTCGCAAAAGG
>probe:Drosophila_2:1640914_at:55:83; Interrogation_Position=518; Antisense; AGGGATCATTCCGTGCTCAGCCAAA
>probe:Drosophila_2:1640914_at:551:413; Interrogation_Position=552; Antisense; GACCAGTTCCACTCAGTTGAAGCGA
>probe:Drosophila_2:1640914_at:207:225; Interrogation_Position=613; Antisense; AAGGATGCCAGTACGCTGAGCAAGA
>probe:Drosophila_2:1640914_at:400:471; Interrogation_Position=653; Antisense; GTTCGCCTGAAAAGTCGGGTGCACA
>probe:Drosophila_2:1640914_at:1:81; Interrogation_Position=691; Antisense; AGGTCTGCAGATCGACTCGGCAATG
>probe:Drosophila_2:1640914_at:378:279; Interrogation_Position=706; Antisense; CTCGGCAATGCAGAGATTCCGGTCT
>probe:Drosophila_2:1640914_at:698:717; Interrogation_Position=722; Antisense; TTCCGGTCTCAAAACGATGGCGTCT
>probe:Drosophila_2:1640914_at:151:155; Interrogation_Position=827; Antisense; ACAGTGATCCCTCCATGTGATGGAC
>probe:Drosophila_2:1640914_at:710:595; Interrogation_Position=842; Antisense; TGTGATGGACCGCACTGAATCCCAC
>probe:Drosophila_2:1640914_at:589:367; Interrogation_Position=858; Antisense; GAATCCCACATGAAGGCGATCCAAA

Paste this into a BLAST search page for me
AAGACCAAGACCGTGTCGCCAAGGCAGGCACTCCCTGTCCAGCAAGAAGAAAGAAGACCAGTGCCAATTCCTCCAGGTCGTCATTCAGCCTCGCAAAAGGAGGGATCATTCCGTGCTCAGCCAAAGACCAGTTCCACTCAGTTGAAGCGAAAGGATGCCAGTACGCTGAGCAAGAGTTCGCCTGAAAAGTCGGGTGCACAAGGTCTGCAGATCGACTCGGCAATGCTCGGCAATGCAGAGATTCCGGTCTTTCCGGTCTCAAAACGATGGCGTCTACAGTGATCCCTCCATGTGATGGACTGTGATGGACCGCACTGAATCCCACGAATCCCACATGAAGGCGATCCAAA

Full Affymetrix probeset data:

Annotations for 1640914_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720