FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640915_at:

>probe:Drosophila_2:1640915_at:643:365; Interrogation_Position=1778; Antisense; GAATCAGGCGGCTAGAAGATCAGGC
>probe:Drosophila_2:1640915_at:23:215; Interrogation_Position=1793; Antisense; AAGATCAGGCCACGTTACCACTCGA
>probe:Drosophila_2:1640915_at:18:627; Interrogation_Position=1847; Antisense; TGCCGGCGAGCCTTGGGAATTATCC
>probe:Drosophila_2:1640915_at:566:599; Interrogation_Position=1898; Antisense; TGTAGACAGTAACCAGTATCCCACC
>probe:Drosophila_2:1640915_at:671:269; Interrogation_Position=1967; Antisense; CATCAGCCAAGACGCCTGGCAAGAT
>probe:Drosophila_2:1640915_at:355:61; Interrogation_Position=2014; Antisense; ATGTAGCTCATAGCTGTGGAGCCAA
>probe:Drosophila_2:1640915_at:682:63; Interrogation_Position=2096; Antisense; ATGGTAGACATACACGACGACTTTG
>probe:Drosophila_2:1640915_at:425:691; Interrogation_Position=2117; Antisense; TTTGAAAACGGAACGCAACGCTGGA
>probe:Drosophila_2:1640915_at:155:115; Interrogation_Position=2166; Antisense; AGCAGACAAGCAAGCGGCACTCAGA
>probe:Drosophila_2:1640915_at:432:567; Interrogation_Position=2181; Antisense; GGCACTCAGAACACTCAGTGGGCAG
>probe:Drosophila_2:1640915_at:675:613; Interrogation_Position=2207; Antisense; TGAAGAAGACAACGGCACACACACA
>probe:Drosophila_2:1640915_at:4:713; Interrogation_Position=2244; Antisense; TTCAGTTGGACGGACGGGACACAAA
>probe:Drosophila_2:1640915_at:660:407; Interrogation_Position=2256; Antisense; GACGGGACACAAAAGATGCGAGACC
>probe:Drosophila_2:1640915_at:674:621; Interrogation_Position=2272; Antisense; TGCGAGACCGAAACCTACGTACGAT

Paste this into a BLAST search page for me
GAATCAGGCGGCTAGAAGATCAGGCAAGATCAGGCCACGTTACCACTCGATGCCGGCGAGCCTTGGGAATTATCCTGTAGACAGTAACCAGTATCCCACCCATCAGCCAAGACGCCTGGCAAGATATGTAGCTCATAGCTGTGGAGCCAAATGGTAGACATACACGACGACTTTGTTTGAAAACGGAACGCAACGCTGGAAGCAGACAAGCAAGCGGCACTCAGAGGCACTCAGAACACTCAGTGGGCAGTGAAGAAGACAACGGCACACACACATTCAGTTGGACGGACGGGACACAAAGACGGGACACAAAAGATGCGAGACCTGCGAGACCGAAACCTACGTACGAT

Full Affymetrix probeset data:

Annotations for 1640915_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720