FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640917_at:

>probe:Drosophila_2:1640917_at:187:669; Interrogation_Position=1792; Antisense; TACTTTATGTTCTGGCACTTGGAGC
>probe:Drosophila_2:1640917_at:236:439; Interrogation_Position=1825; Antisense; GAGGCCACTGGTTACATGCATCAGA
>probe:Drosophila_2:1640917_at:648:623; Interrogation_Position=1901; Antisense; TGCCCTTTTTCTTCTACAGCGGAAA
>probe:Drosophila_2:1640917_at:353:571; Interrogation_Position=1942; Antisense; GGCTATCTCTTTTTCCAGGGCATTA
>probe:Drosophila_2:1640917_at:51:15; Interrogation_Position=1963; Antisense; ATTACCTATGCTCTGTGCTATACGT
>probe:Drosophila_2:1640917_at:208:41; Interrogation_Position=2028; Antisense; ATCGGCCACCGTTCAAGGATTGATG
>probe:Drosophila_2:1640917_at:467:347; Interrogation_Position=2057; Antisense; GCATGGACGATGGACTTGGCTTCTC
>probe:Drosophila_2:1640917_at:650:39; Interrogation_Position=2083; Antisense; ATCGGATCCCTAATCGGCGGACTTA
>probe:Drosophila_2:1640917_at:98:275; Interrogation_Position=2104; Antisense; CTTATGTTCAAAAGCCTGGGCGGAC
>probe:Drosophila_2:1640917_at:569:711; Interrogation_Position=2137; Antisense; TTCAAATACTTTGCCATAGCCGCCA
>probe:Drosophila_2:1640917_at:695:25; Interrogation_Position=2152; Antisense; ATAGCCGCCATTTGCACATGCGTAG
>probe:Drosophila_2:1640917_at:87:487; Interrogation_Position=2173; Antisense; GTAGCACACATCGTTATACGTCCCA
>probe:Drosophila_2:1640917_at:47:687; Interrogation_Position=2187; Antisense; TATACGTCCCACATCCAGGAAGAGG
>probe:Drosophila_2:1640917_at:174:399; Interrogation_Position=2225; Antisense; GACAGGGATATGTGCCGCCAACGGA

Paste this into a BLAST search page for me
TACTTTATGTTCTGGCACTTGGAGCGAGGCCACTGGTTACATGCATCAGATGCCCTTTTTCTTCTACAGCGGAAAGGCTATCTCTTTTTCCAGGGCATTAATTACCTATGCTCTGTGCTATACGTATCGGCCACCGTTCAAGGATTGATGGCATGGACGATGGACTTGGCTTCTCATCGGATCCCTAATCGGCGGACTTACTTATGTTCAAAAGCCTGGGCGGACTTCAAATACTTTGCCATAGCCGCCAATAGCCGCCATTTGCACATGCGTAGGTAGCACACATCGTTATACGTCCCATATACGTCCCACATCCAGGAAGAGGGACAGGGATATGTGCCGCCAACGGA

Full Affymetrix probeset data:

Annotations for 1640917_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720