FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640918_at:

>probe:Drosophila_2:1640918_at:524:727; Interrogation_Position=2067; Antisense; TTGGGCACCGTGGAGATCAGCGATC
>probe:Drosophila_2:1640918_at:69:605; Interrogation_Position=2135; Antisense; TGATCCCGATCACGTTGGCATTTGG
>probe:Drosophila_2:1640918_at:369:287; Interrogation_Position=2162; Antisense; CTGGTCATATGGTGGCTACGCGGCT
>probe:Drosophila_2:1640918_at:85:535; Interrogation_Position=2216; Antisense; GGTGTTCAAGTGTGCAGCCTCGATA
>probe:Drosophila_2:1640918_at:308:27; Interrogation_Position=2238; Antisense; ATAGCTCCAGTCACGGATTGGGCTT
>probe:Drosophila_2:1640918_at:538:465; Interrogation_Position=2253; Antisense; GATTGGGCTTACTATGACTCCATTT
>probe:Drosophila_2:1640918_at:435:265; Interrogation_Position=2281; Antisense; CAGAGCGCTATATGGGTCTTCCCAA
>probe:Drosophila_2:1640918_at:447:525; Interrogation_Position=2294; Antisense; GGGTCTTCCCAACACGAATGAGCTG
>probe:Drosophila_2:1640918_at:264:525; Interrogation_Position=2318; Antisense; GGGCTATGCCAACTCTAGACTGAGC
>probe:Drosophila_2:1640918_at:667:673; Interrogation_Position=2373; Antisense; TACCTTCTGGTACATGGCACACTGG
>probe:Drosophila_2:1640918_at:243:455; Interrogation_Position=2400; Antisense; GATAATGTGCACTACCAGCAGGCCA
>probe:Drosophila_2:1640918_at:653:623; Interrogation_Position=2509; Antisense; TGCGACCCCATTTGTATCATTCATT
>probe:Drosophila_2:1640918_at:223:645; Interrogation_Position=2525; Antisense; TCATTCATTGGATCGCTTCTTTGGC
>probe:Drosophila_2:1640918_at:16:703; Interrogation_Position=2555; Antisense; TTTTGCCAGCAGTCGCCTAATGAAA

Paste this into a BLAST search page for me
TTGGGCACCGTGGAGATCAGCGATCTGATCCCGATCACGTTGGCATTTGGCTGGTCATATGGTGGCTACGCGGCTGGTGTTCAAGTGTGCAGCCTCGATAATAGCTCCAGTCACGGATTGGGCTTGATTGGGCTTACTATGACTCCATTTCAGAGCGCTATATGGGTCTTCCCAAGGGTCTTCCCAACACGAATGAGCTGGGGCTATGCCAACTCTAGACTGAGCTACCTTCTGGTACATGGCACACTGGGATAATGTGCACTACCAGCAGGCCATGCGACCCCATTTGTATCATTCATTTCATTCATTGGATCGCTTCTTTGGCTTTTGCCAGCAGTCGCCTAATGAAA

Full Affymetrix probeset data:

Annotations for 1640918_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720