FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640919_at:

>probe:Drosophila_2:1640919_at:527:551; Interrogation_Position=102; Antisense; GGAGATCCTATTGCATTTCGGCTGC
>probe:Drosophila_2:1640919_at:653:211; Interrogation_Position=147; Antisense; AAGACGCTTCAAGTGGCATTGGTGT
>probe:Drosophila_2:1640919_at:153:571; Interrogation_Position=161; Antisense; GGCATTGGTGTTTTGAGCGACTGAA
>probe:Drosophila_2:1640919_at:411:595; Interrogation_Position=209; Antisense; TGTGGACAACGCATTTTGGCTTTGA
>probe:Drosophila_2:1640919_at:25:167; Interrogation_Position=243; Antisense; AAATGCGGTTGCCACACATGCGAAA
>probe:Drosophila_2:1640919_at:655:25; Interrogation_Position=311; Antisense; ATAGCCAGGCATGCGAAACCATCAA
>probe:Drosophila_2:1640919_at:360:191; Interrogation_Position=327; Antisense; AACCATCAACGCAGGCCGGGAAAAG
>probe:Drosophila_2:1640919_at:80:13; Interrogation_Position=356; Antisense; ATTCAGGTTCCCGTATGCAGGTCAT
>probe:Drosophila_2:1640919_at:634:397; Interrogation_Position=408; Antisense; GACAACGCAATGCAGGTGCCACCGA
>probe:Drosophila_2:1640919_at:61:87; Interrogation_Position=480; Antisense; AGTGCATCCAGAGCCATGCGTGACA
>probe:Drosophila_2:1640919_at:327:687; Interrogation_Position=511; Antisense; TATTAACTGCCACAACTGCCGGGCA
>probe:Drosophila_2:1640919_at:469:305; Interrogation_Position=529; Antisense; CCGGGCATCGGCTTAGAGGATTGAT
>probe:Drosophila_2:1640919_at:677:463; Interrogation_Position=582; Antisense; GATTCCGACTTCGTCAATTGTCACA
>probe:Drosophila_2:1640919_at:703:413; Interrogation_Position=87; Antisense; GAGCCGATTTCACAAGGAGATCCTA

Paste this into a BLAST search page for me
GGAGATCCTATTGCATTTCGGCTGCAAGACGCTTCAAGTGGCATTGGTGTGGCATTGGTGTTTTGAGCGACTGAATGTGGACAACGCATTTTGGCTTTGAAAATGCGGTTGCCACACATGCGAAAATAGCCAGGCATGCGAAACCATCAAAACCATCAACGCAGGCCGGGAAAAGATTCAGGTTCCCGTATGCAGGTCATGACAACGCAATGCAGGTGCCACCGAAGTGCATCCAGAGCCATGCGTGACATATTAACTGCCACAACTGCCGGGCACCGGGCATCGGCTTAGAGGATTGATGATTCCGACTTCGTCAATTGTCACAGAGCCGATTTCACAAGGAGATCCTA

Full Affymetrix probeset data:

Annotations for 1640919_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720