FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640920_at:

>probe:Drosophila_2:1640920_at:630:355; Interrogation_Position=1462; Antisense; GCACTACAATGTGGCTCGAGCAGTT
>probe:Drosophila_2:1640920_at:34:405; Interrogation_Position=1492; Antisense; GACTCTGCAGGCTTACAAGTCGCTG
>probe:Drosophila_2:1640920_at:5:559; Interrogation_Position=1519; Antisense; GGACATCATCGCCATTCTGGGAATG
>probe:Drosophila_2:1640920_at:91:309; Interrogation_Position=1578; Antisense; CCAGGGCTCGCAAGATGCAGCGTTT
>probe:Drosophila_2:1640920_at:322:215; Interrogation_Position=1589; Antisense; AAGATGCAGCGTTTCCTTTCGCAGC
>probe:Drosophila_2:1640920_at:329:319; Interrogation_Position=1612; Antisense; GCCGTTCCAAGTGGCTGAGATCTTC
>probe:Drosophila_2:1640920_at:138:609; Interrogation_Position=1627; Antisense; TGAGATCTTCACTGGACACCCGGGA
>probe:Drosophila_2:1640920_at:193:157; Interrogation_Position=1642; Antisense; ACACCCGGGAAAGCTGGTGCCTGTG
>probe:Drosophila_2:1640920_at:568:509; Interrogation_Position=1674; Antisense; GTGTGGAGGGCTTCAAACGTTTGTT
>probe:Drosophila_2:1640920_at:58:511; Interrogation_Position=1704; Antisense; GTGAATATGACGATATCCCGGAGAT
>probe:Drosophila_2:1640920_at:126:685; Interrogation_Position=1717; Antisense; TATCCCGGAGATTGCCTTCTACATG
>probe:Drosophila_2:1640920_at:389:315; Interrogation_Position=1730; Antisense; GCCTTCTACATGGTCGGAGATGCCG
>probe:Drosophila_2:1640920_at:679:545; Interrogation_Position=1801; Antisense; GGATGCTCCTCCAGCCAAGGCGGAA
>probe:Drosophila_2:1640920_at:229:453; Interrogation_Position=1959; Antisense; GATCAGCAATTCCACCAACCATTAA

Paste this into a BLAST search page for me
GCACTACAATGTGGCTCGAGCAGTTGACTCTGCAGGCTTACAAGTCGCTGGGACATCATCGCCATTCTGGGAATGCCAGGGCTCGCAAGATGCAGCGTTTAAGATGCAGCGTTTCCTTTCGCAGCGCCGTTCCAAGTGGCTGAGATCTTCTGAGATCTTCACTGGACACCCGGGAACACCCGGGAAAGCTGGTGCCTGTGGTGTGGAGGGCTTCAAACGTTTGTTGTGAATATGACGATATCCCGGAGATTATCCCGGAGATTGCCTTCTACATGGCCTTCTACATGGTCGGAGATGCCGGGATGCTCCTCCAGCCAAGGCGGAAGATCAGCAATTCCACCAACCATTAA

Full Affymetrix probeset data:

Annotations for 1640920_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720