FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640921_at:

>probe:Drosophila_2:1640921_at:721:121; Interrogation_Position=438; Antisense; AGCGTCTGATCACACTGCGTAATAA
>probe:Drosophila_2:1640921_at:435:235; Interrogation_Position=476; Antisense; AATCCAGATGCGTGCCAGGATCTAA
>probe:Drosophila_2:1640921_at:567:159; Interrogation_Position=500; Antisense; AAAATTCGGGATCTCTGGACCCCAG
>probe:Drosophila_2:1640921_at:226:719; Interrogation_Position=545; Antisense; TTGCGTGACCAGAAGTGCCAACTTA
>probe:Drosophila_2:1640921_at:60:505; Interrogation_Position=559; Antisense; GTGCCAACTTATTTGCCAACTTCAA
>probe:Drosophila_2:1640921_at:284:213; Interrogation_Position=582; Antisense; AAGAGGCAACCCAGCACCTGAAGGA
>probe:Drosophila_2:1640921_at:478:383; Interrogation_Position=626; Antisense; GAACTGGAGACTTGGCGATGCCACC
>probe:Drosophila_2:1640921_at:490:331; Interrogation_Position=676; Antisense; GCGGCAGCTTAGTCAGTTCGAGAAC
>probe:Drosophila_2:1640921_at:631:369; Interrogation_Position=709; Antisense; GAAGGTTATCCACCAATTCGGGCTG
>probe:Drosophila_2:1640921_at:24:247; Interrogation_Position=723; Antisense; AATTCGGGCTGTGCATCGAGCGTTG
>probe:Drosophila_2:1640921_at:556:501; Interrogation_Position=884; Antisense; GTCGAGCTTATGCTGGTCCGCGTTT
>probe:Drosophila_2:1640921_at:101:251; Interrogation_Position=916; Antisense; CAATCTCTTCGAGGCGATGGTCAAC
>probe:Drosophila_2:1640921_at:608:401; Interrogation_Position=941; Antisense; GACTTTAGGTTCTTTAGCCGCCACA
>probe:Drosophila_2:1640921_at:700:275; Interrogation_Position=952; Antisense; CTTTAGCCGCCACATGAGCATTAAG

Paste this into a BLAST search page for me
AGCGTCTGATCACACTGCGTAATAAAATCCAGATGCGTGCCAGGATCTAAAAAATTCGGGATCTCTGGACCCCAGTTGCGTGACCAGAAGTGCCAACTTAGTGCCAACTTATTTGCCAACTTCAAAAGAGGCAACCCAGCACCTGAAGGAGAACTGGAGACTTGGCGATGCCACCGCGGCAGCTTAGTCAGTTCGAGAACGAAGGTTATCCACCAATTCGGGCTGAATTCGGGCTGTGCATCGAGCGTTGGTCGAGCTTATGCTGGTCCGCGTTTCAATCTCTTCGAGGCGATGGTCAACGACTTTAGGTTCTTTAGCCGCCACACTTTAGCCGCCACATGAGCATTAAG

Full Affymetrix probeset data:

Annotations for 1640921_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720