FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640923_at:

>probe:Drosophila_2:1640923_at:428:541; Interrogation_Position=1039; Antisense; GGTTCTCTATTCATAATGCGTGCCT
>probe:Drosophila_2:1640923_at:10:53; Interrogation_Position=1054; Antisense; ATGCGTGCCTTCATTAATCCCAAGC
>probe:Drosophila_2:1640923_at:285:385; Interrogation_Position=1098; Antisense; GAACTTCCTGGAACATATGGCCCTG
>probe:Drosophila_2:1640923_at:343:81; Interrogation_Position=1139; Antisense; AGGGAACTCCCGTCCAGATGGTCAG
>probe:Drosophila_2:1640923_at:133:325; Interrogation_Position=1163; Antisense; GCGAAATACTTGATGCTTACGACTT
>probe:Drosophila_2:1640923_at:350:19; Interrogation_Position=1276; Antisense; ATTTCGTCGTATGTCACCTATGCAA
>probe:Drosophila_2:1640923_at:470:23; Interrogation_Position=1328; Antisense; ATATCTTTGAGTTTGCCGGCCTAAA
>probe:Drosophila_2:1640923_at:42:171; Interrogation_Position=1362; Antisense; AAAGTTTTTTGCTGGCACCACTGAC
>probe:Drosophila_2:1640923_at:167:445; Interrogation_Position=1414; Antisense; GATGATGGTCTGCACACCATACGCA
>probe:Drosophila_2:1640923_at:698:671; Interrogation_Position=1433; Antisense; TACGCATTCCGGTTAGCTTCGATGA
>probe:Drosophila_2:1640923_at:664:343; Interrogation_Position=1448; Antisense; GCTTCGATGATTTTCCCAAGGACTC
>probe:Drosophila_2:1640923_at:635:275; Interrogation_Position=1502; Antisense; CTTCGCTGATGACGGATTTCGCCAA
>probe:Drosophila_2:1640923_at:110:79; Interrogation_Position=984; Antisense; AGGTCGCATTAACCAGATGCCCTGG
>probe:Drosophila_2:1640923_at:422:447; Interrogation_Position=999; Antisense; GATGCCCTGGATACTAAGCCTAAGT

Paste this into a BLAST search page for me
GGTTCTCTATTCATAATGCGTGCCTATGCGTGCCTTCATTAATCCCAAGCGAACTTCCTGGAACATATGGCCCTGAGGGAACTCCCGTCCAGATGGTCAGGCGAAATACTTGATGCTTACGACTTATTTCGTCGTATGTCACCTATGCAAATATCTTTGAGTTTGCCGGCCTAAAAAAGTTTTTTGCTGGCACCACTGACGATGATGGTCTGCACACCATACGCATACGCATTCCGGTTAGCTTCGATGAGCTTCGATGATTTTCCCAAGGACTCCTTCGCTGATGACGGATTTCGCCAAAGGTCGCATTAACCAGATGCCCTGGGATGCCCTGGATACTAAGCCTAAGT

Full Affymetrix probeset data:

Annotations for 1640923_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720