FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640926_at:

>probe:Drosophila_2:1640926_at:344:51; Interrogation_Position=13; Antisense; ATGCTTCCTATAGCCGTAAGATTTA
>probe:Drosophila_2:1640926_at:713:163; Interrogation_Position=294; Antisense; AAAGGTTAGCTTGCGGCAACCACCA
>probe:Drosophila_2:1640926_at:92:247; Interrogation_Position=329; Antisense; AATTCACCAAAACTGCTGATGGTTA
>probe:Drosophila_2:1640926_at:566:457; Interrogation_Position=364; Antisense; GATAGTGATGACTGCCCAATCCCTT
>probe:Drosophila_2:1640926_at:182:411; Interrogation_Position=395; Antisense; GACGCACTCCATCTGGCGGTTTATT
>probe:Drosophila_2:1640926_at:9:289; Interrogation_Position=407; Antisense; CTGGCGGTTTATTGGCACAGGACCA
>probe:Drosophila_2:1640926_at:123:729; Interrogation_Position=418; Antisense; TTGGCACAGGACCAGCGGACAAGTC
>probe:Drosophila_2:1640926_at:521:559; Interrogation_Position=434; Antisense; GGACAAGTCGCTGTCACGCTGCGGC
>probe:Drosophila_2:1640926_at:547:577; Interrogation_Position=456; Antisense; GGCCCAACTAATTGCAGTCGCATTA
>probe:Drosophila_2:1640926_at:18:503; Interrogation_Position=472; Antisense; GTCGCATTAATTAAGGCACACTCAA
>probe:Drosophila_2:1640926_at:502:649; Interrogation_Position=493; Antisense; TCAAAATTGCCCAATAACCGGCCGA
>probe:Drosophila_2:1640926_at:193:243; Interrogation_Position=504; Antisense; CAATAACCGGCCGACAGATAAGCAG
>probe:Drosophila_2:1640926_at:90:341; Interrogation_Position=58; Antisense; GCTAAATCAGGCTTGTTGTGGAACG
>probe:Drosophila_2:1640926_at:410:371; Interrogation_Position=84; Antisense; GAAGATTTTGGTATTCTATGCGGAA

Paste this into a BLAST search page for me
ATGCTTCCTATAGCCGTAAGATTTAAAAGGTTAGCTTGCGGCAACCACCAAATTCACCAAAACTGCTGATGGTTAGATAGTGATGACTGCCCAATCCCTTGACGCACTCCATCTGGCGGTTTATTCTGGCGGTTTATTGGCACAGGACCATTGGCACAGGACCAGCGGACAAGTCGGACAAGTCGCTGTCACGCTGCGGCGGCCCAACTAATTGCAGTCGCATTAGTCGCATTAATTAAGGCACACTCAATCAAAATTGCCCAATAACCGGCCGACAATAACCGGCCGACAGATAAGCAGGCTAAATCAGGCTTGTTGTGGAACGGAAGATTTTGGTATTCTATGCGGAA

Full Affymetrix probeset data:

Annotations for 1640926_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720