FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640927_at:

>probe:Drosophila_2:1640927_at:191:111; Interrogation_Position=429; Antisense; AGAATAAGACCCTCGATCTGGCGCA
>probe:Drosophila_2:1640927_at:356:41; Interrogation_Position=444; Antisense; ATCTGGCGCATTTCCTGAACGAGTG
>probe:Drosophila_2:1640927_at:645:223; Interrogation_Position=473; Antisense; AAGGATGAGCACCACATCTGGCACG
>probe:Drosophila_2:1640927_at:523:619; Interrogation_Position=498; Antisense; TGCTTCGCTATATCCAGGCTATTTT
>probe:Drosophila_2:1640927_at:246:341; Interrogation_Position=515; Antisense; GCTATTTTCGCGGATCCAGAGGGCA
>probe:Drosophila_2:1640927_at:151:569; Interrogation_Position=536; Antisense; GGCAGTATTTGCACCGGACAATCCT
>probe:Drosophila_2:1640927_at:152:107; Interrogation_Position=674; Antisense; AGAAATCTTATCTACGACCGACCAC
>probe:Drosophila_2:1640927_at:172:21; Interrogation_Position=717; Antisense; ATATTATCGTGGAGCCCTATTGTGC
>probe:Drosophila_2:1640927_at:278:225; Interrogation_Position=788; Antisense; AAGGAGGCCACTTCCATGGACTGCT
>probe:Drosophila_2:1640927_at:208:429; Interrogation_Position=824; Antisense; GAGTACCTGGGACACATCGATTCCT
>probe:Drosophila_2:1640927_at:89:551; Interrogation_Position=883; Antisense; GGAGAAGCTACATCGCGGACGTATT
>probe:Drosophila_2:1640927_at:495:137; Interrogation_Position=901; Antisense; ACGTATTCCGGAACACCAGCGTGAA
>probe:Drosophila_2:1640927_at:5:433; Interrogation_Position=926; Antisense; GAGTCGGAAGTTTCCCTGTAGCTTA
>probe:Drosophila_2:1640927_at:52:427; Interrogation_Position=954; Antisense; GAGATGCTAGCATACACGACCCATA

Paste this into a BLAST search page for me
AGAATAAGACCCTCGATCTGGCGCAATCTGGCGCATTTCCTGAACGAGTGAAGGATGAGCACCACATCTGGCACGTGCTTCGCTATATCCAGGCTATTTTGCTATTTTCGCGGATCCAGAGGGCAGGCAGTATTTGCACCGGACAATCCTAGAAATCTTATCTACGACCGACCACATATTATCGTGGAGCCCTATTGTGCAAGGAGGCCACTTCCATGGACTGCTGAGTACCTGGGACACATCGATTCCTGGAGAAGCTACATCGCGGACGTATTACGTATTCCGGAACACCAGCGTGAAGAGTCGGAAGTTTCCCTGTAGCTTAGAGATGCTAGCATACACGACCCATA

Full Affymetrix probeset data:

Annotations for 1640927_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720