Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640929_at:

>probe:Drosophila_2:1640929_at:131:261; Interrogation_Position=1024; Antisense; CAGAGAACGACAGCGCAACCGGGAT
>probe:Drosophila_2:1640929_at:571:155; Interrogation_Position=1068; Antisense; ACAACGGACGCGGTCCTGAGGAGAA
>probe:Drosophila_2:1640929_at:537:609; Interrogation_Position=1099; Antisense; TGAGCGACCCAAGGAAGCGGCAGAT
>probe:Drosophila_2:1640929_at:257:427; Interrogation_Position=1167; Antisense; GAGATGACAGGGACAACCACGGCAG
>probe:Drosophila_2:1640929_at:669:201; Interrogation_Position=1181; Antisense; AACCACGGCAGGGATCATCGCGAAC
>probe:Drosophila_2:1640929_at:461:545; Interrogation_Position=1225; Antisense; GGATCGGGACCGACATGGACGCAAC
>probe:Drosophila_2:1640929_at:295:199; Interrogation_Position=1247; Antisense; AACGACAGAGGACGCTTTGGTGACA
>probe:Drosophila_2:1640929_at:486:521; Interrogation_Position=1293; Antisense; GTGGCCATCACCGTGACGACAGACG
>probe:Drosophila_2:1640929_at:111:105; Interrogation_Position=1313; Antisense; AGACGCCGCTCAAGGTCCAGGGAAC
>probe:Drosophila_2:1640929_at:478:321; Interrogation_Position=1354; Antisense; GCGGAACTTTAACCACTTCAGGGAT
>probe:Drosophila_2:1640929_at:495:167; Interrogation_Position=1393; Antisense; AAATGGCCAGCGCAAACGATCCTAC
>probe:Drosophila_2:1640929_at:119:325; Interrogation_Position=1461; Antisense; GCGCACGTACGTAGCATTAATCACA
>probe:Drosophila_2:1640929_at:703:379; Interrogation_Position=1529; Antisense; GAACCGAATATTCTTAGCGTAACCA
>probe:Drosophila_2:1640929_at:469:209; Interrogation_Position=1557; Antisense; AAGCAACCTAGAGCCACACTTTCGA

Paste this into a BLAST search page for me
CAGAGAACGACAGCGCAACCGGGATACAACGGACGCGGTCCTGAGGAGAATGAGCGACCCAAGGAAGCGGCAGATGAGATGACAGGGACAACCACGGCAGAACCACGGCAGGGATCATCGCGAACGGATCGGGACCGACATGGACGCAACAACGACAGAGGACGCTTTGGTGACAGTGGCCATCACCGTGACGACAGACGAGACGCCGCTCAAGGTCCAGGGAACGCGGAACTTTAACCACTTCAGGGATAAATGGCCAGCGCAAACGATCCTACGCGCACGTACGTAGCATTAATCACAGAACCGAATATTCTTAGCGTAACCAAAGCAACCTAGAGCCACACTTTCGA

Full Affymetrix probeset data:

Annotations for 1640929_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime