FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640930_at:

>probe:Drosophila_2:1640930_at:172:149; Interrogation_Position=3350; Antisense; ACTATTCCGGATGTGCTGAACAGCA
>probe:Drosophila_2:1640930_at:446:155; Interrogation_Position=3369; Antisense; ACAGCATGGCCGGTGGCGCTCAGTT
>probe:Drosophila_2:1640930_at:628:517; Interrogation_Position=3419; Antisense; GTGGATCTGGCCTCCTCGGCAAGCA
>probe:Drosophila_2:1640930_at:322:87; Interrogation_Position=3449; Antisense; AGTGCCATCAACATCGTGCCGCACG
>probe:Drosophila_2:1640930_at:626:485; Interrogation_Position=3577; Antisense; GTAGTAGCAGCAGACGCAGTTTGTA
>probe:Drosophila_2:1640930_at:234:107; Interrogation_Position=3612; Antisense; AGAACTAGCTTTCCTTCGCTAAACA
>probe:Drosophila_2:1640930_at:386:341; Interrogation_Position=3619; Antisense; GCTTTCCTTCGCTAAACAAATGTCT
>probe:Drosophila_2:1640930_at:248:59; Interrogation_Position=3638; Antisense; ATGTCTATTGGGAAAACCCGCACAG
>probe:Drosophila_2:1640930_at:662:475; Interrogation_Position=3680; Antisense; GTTATTGGTTCTTCATATTTTCATA
>probe:Drosophila_2:1640930_at:216:1; Interrogation_Position=3726; Antisense; AGGTTTAATAAATCGCTGACTCCAC
>probe:Drosophila_2:1640930_at:407:45; Interrogation_Position=3737; Antisense; ATCGCTGACTCCACGCAATAATTAT
>probe:Drosophila_2:1640930_at:51:191; Interrogation_Position=3796; Antisense; AACTTGTTTAGCACATTGCAATTTG
>probe:Drosophila_2:1640930_at:566:293; Interrogation_Position=3843; Antisense; CGAGGCAATAAGTAAGACGCGCATT
>probe:Drosophila_2:1640930_at:180:493; Interrogation_Position=3854; Antisense; GTAAGACGCGCATTCATATTATAAT

Paste this into a BLAST search page for me
ACTATTCCGGATGTGCTGAACAGCAACAGCATGGCCGGTGGCGCTCAGTTGTGGATCTGGCCTCCTCGGCAAGCAAGTGCCATCAACATCGTGCCGCACGGTAGTAGCAGCAGACGCAGTTTGTAAGAACTAGCTTTCCTTCGCTAAACAGCTTTCCTTCGCTAAACAAATGTCTATGTCTATTGGGAAAACCCGCACAGGTTATTGGTTCTTCATATTTTCATAAGGTTTAATAAATCGCTGACTCCACATCGCTGACTCCACGCAATAATTATAACTTGTTTAGCACATTGCAATTTGCGAGGCAATAAGTAAGACGCGCATTGTAAGACGCGCATTCATATTATAAT

Full Affymetrix probeset data:

Annotations for 1640930_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720