FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640934_at:

>probe:Drosophila_2:1640934_at:332:381; Interrogation_Position=130; Antisense; GAACCCATTTGTATGTGCATCCCGG
>probe:Drosophila_2:1640934_at:584:617; Interrogation_Position=145; Antisense; TGCATCCCGGAGTCACTAGTTGAAT
>probe:Drosophila_2:1640934_at:140:289; Interrogation_Position=152; Antisense; CGGAGTCACTAGTTGAATGCATCTA
>probe:Drosophila_2:1640934_at:685:367; Interrogation_Position=166; Antisense; GAATGCATCTAACCAGTTGAATCCA
>probe:Drosophila_2:1640934_at:371:465; Interrogation_Position=181; Antisense; GTTGAATCCATTTCATACGAACCCA
>probe:Drosophila_2:1640934_at:474:23; Interrogation_Position=195; Antisense; ATACGAACCCAAAACGGCAGATCGC
>probe:Drosophila_2:1640934_at:282:439; Interrogation_Position=454; Antisense; GATGGTAAGTGGTGCAAATGCTCGT
>probe:Drosophila_2:1640934_at:569:619; Interrogation_Position=472; Antisense; TGCTCGTGGGAGCAAAATGCGAAAT
>probe:Drosophila_2:1640934_at:500:143; Interrogation_Position=536; Antisense; ACTGACTAATGACTAATGGCCCTTT
>probe:Drosophila_2:1640934_at:708:67; Interrogation_Position=551; Antisense; ATGGCCCTTTGTTGTTAATTTGCGA
>probe:Drosophila_2:1640934_at:404:711; Interrogation_Position=570; Antisense; TTGCGATTCGAAGCAAAAGGCTCGA
>probe:Drosophila_2:1640934_at:614:697; Interrogation_Position=626; Antisense; TTTACTCATAAATCTCCTACTGGTT
>probe:Drosophila_2:1640934_at:580:237; Interrogation_Position=636; Antisense; AATCTCCTACTGGTTTCATTTCTCG
>probe:Drosophila_2:1640934_at:577:669; Interrogation_Position=643; Antisense; TACTGGTTTCATTTCTCGACAGCCG

Paste this into a BLAST search page for me
GAACCCATTTGTATGTGCATCCCGGTGCATCCCGGAGTCACTAGTTGAATCGGAGTCACTAGTTGAATGCATCTAGAATGCATCTAACCAGTTGAATCCAGTTGAATCCATTTCATACGAACCCAATACGAACCCAAAACGGCAGATCGCGATGGTAAGTGGTGCAAATGCTCGTTGCTCGTGGGAGCAAAATGCGAAATACTGACTAATGACTAATGGCCCTTTATGGCCCTTTGTTGTTAATTTGCGATTGCGATTCGAAGCAAAAGGCTCGATTTACTCATAAATCTCCTACTGGTTAATCTCCTACTGGTTTCATTTCTCGTACTGGTTTCATTTCTCGACAGCCG

Full Affymetrix probeset data:

Annotations for 1640934_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720