FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640938_at:

>probe:Drosophila_2:1640938_at:268:483; Interrogation_Position=229; Antisense; GGGCTAACCATTCTAATGTCCAAGG
>probe:Drosophila_2:1640938_at:325:617; Interrogation_Position=275; Antisense; TGCAGAACGTGCTCAGCCAAACTGA
>probe:Drosophila_2:1640938_at:123:625; Interrogation_Position=334; Antisense; TCGATGGTCATTACGAACGCCCACA
>probe:Drosophila_2:1640938_at:331:77; Interrogation_Position=365; Antisense; AGGTGCTCGAGTGCTGGGACTTTAA
>probe:Drosophila_2:1640938_at:275:583; Interrogation_Position=411; Antisense; TGGCGATATCAGTGATCCCACCAAG
>probe:Drosophila_2:1640938_at:404:407; Interrogation_Position=481; Antisense; GACGTTATGCGGCAGATCTCGGCCA
>probe:Drosophila_2:1640938_at:603:115; Interrogation_Position=511; Antisense; AGCTATTTGCCACTGCTCGATTGCA
>probe:Drosophila_2:1640938_at:174:619; Interrogation_Position=532; Antisense; TGCATCTGCACCTTCGACATAATGA
>probe:Drosophila_2:1640938_at:553:401; Interrogation_Position=547; Antisense; GACATAATGATTCACACGCTGCAGA
>probe:Drosophila_2:1640938_at:213:391; Interrogation_Position=598; Antisense; GAAACGGGTGCCATTGTCATACAGA
>probe:Drosophila_2:1640938_at:209:729; Interrogation_Position=611; Antisense; TTGTCATACAGAATCCGCAGGCCGT
>probe:Drosophila_2:1640938_at:259:337; Interrogation_Position=644; Antisense; GCTCCTTTTCTACAGGACTGCACAA
>probe:Drosophila_2:1640938_at:637:1; Interrogation_Position=668; Antisense; AGGTGGACACCGTGGTCAACTACAA
>probe:Drosophila_2:1640938_at:303:487; Interrogation_Position=712; Antisense; GTACCGCCTCATCCTAATGTTTAAA

Paste this into a BLAST search page for me
GGGCTAACCATTCTAATGTCCAAGGTGCAGAACGTGCTCAGCCAAACTGATCGATGGTCATTACGAACGCCCACAAGGTGCTCGAGTGCTGGGACTTTAATGGCGATATCAGTGATCCCACCAAGGACGTTATGCGGCAGATCTCGGCCAAGCTATTTGCCACTGCTCGATTGCATGCATCTGCACCTTCGACATAATGAGACATAATGATTCACACGCTGCAGAGAAACGGGTGCCATTGTCATACAGATTGTCATACAGAATCCGCAGGCCGTGCTCCTTTTCTACAGGACTGCACAAAGGTGGACACCGTGGTCAACTACAAGTACCGCCTCATCCTAATGTTTAAA

Full Affymetrix probeset data:

Annotations for 1640938_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720