Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640942_at:

>probe:Drosophila_2:1640942_at:48:507; Interrogation_Position=1039; Antisense; GTGCCAGGTGCAGTTGGATACCAAT
>probe:Drosophila_2:1640942_at:498:457; Interrogation_Position=1055; Antisense; GATACCAATAGACGCGATCTGCTCA
>probe:Drosophila_2:1640942_at:690:323; Interrogation_Position=1080; Antisense; GCGCTTGTTACATCCAATCGATCGA
>probe:Drosophila_2:1640942_at:38:389; Interrogation_Position=1146; Antisense; GAAAACTGGTTGATGTGCCCTCCGA
>probe:Drosophila_2:1640942_at:133:361; Interrogation_Position=1196; Antisense; GAATTCAAGGCCTGGGACTTTGCTC
>probe:Drosophila_2:1640942_at:454:513; Interrogation_Position=1275; Antisense; GTGATCAGCAAGGATTCGTCCCTGA
>probe:Drosophila_2:1640942_at:715:443; Interrogation_Position=1346; Antisense; GATCCTCGTCCGGTTAACGTAACAG
>probe:Drosophila_2:1640942_at:255:699; Interrogation_Position=1386; Antisense; TTTTCGGGCCCTCTAGATGGATGGA
>probe:Drosophila_2:1640942_at:194:319; Interrogation_Position=1420; Antisense; GCCGTTGATGCCTAATCCTTTGATG
>probe:Drosophila_2:1640942_at:295:399; Interrogation_Position=1453; Antisense; GACAGGATCGTTCGTTTTCGTCCAA
>probe:Drosophila_2:1640942_at:152:179; Interrogation_Position=1466; Antisense; GTTTTCGTCCAACAACCACGAGTTG
>probe:Drosophila_2:1640942_at:714:291; Interrogation_Position=1497; Antisense; CGTCGGTCATGATGCACGTTTTGAT
>probe:Drosophila_2:1640942_at:230:491; Interrogation_Position=1526; Antisense; GTACACAACGCACCATACATGCTTG
>probe:Drosophila_2:1640942_at:420:667; Interrogation_Position=1541; Antisense; TACATGCTTGCGTTTGATCATGCCC

Paste this into a BLAST search page for me
GTGCCAGGTGCAGTTGGATACCAATGATACCAATAGACGCGATCTGCTCAGCGCTTGTTACATCCAATCGATCGAGAAAACTGGTTGATGTGCCCTCCGAGAATTCAAGGCCTGGGACTTTGCTCGTGATCAGCAAGGATTCGTCCCTGAGATCCTCGTCCGGTTAACGTAACAGTTTTCGGGCCCTCTAGATGGATGGAGCCGTTGATGCCTAATCCTTTGATGGACAGGATCGTTCGTTTTCGTCCAAGTTTTCGTCCAACAACCACGAGTTGCGTCGGTCATGATGCACGTTTTGATGTACACAACGCACCATACATGCTTGTACATGCTTGCGTTTGATCATGCCC

Full Affymetrix probeset data:

Annotations for 1640942_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime