FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640943_at:

>probe:Drosophila_2:1640943_at:702:577; Interrogation_Position=1175; Antisense; GGCCGGCCAAAGTTGTCACGCAAGT
>probe:Drosophila_2:1640943_at:319:417; Interrogation_Position=1229; Antisense; GAGCTGGCCCAGATCGCCGATAGTA
>probe:Drosophila_2:1640943_at:705:709; Interrogation_Position=1254; Antisense; TTAACCTGAACGAGAGCACCGGCTT
>probe:Drosophila_2:1640943_at:78:41; Interrogation_Position=1282; Antisense; ATCGGACAGCTCCAGCAATTCAAGC
>probe:Drosophila_2:1640943_at:501:463; Interrogation_Position=1364; Antisense; GATTCCAACACGGACAGCGGCCAGG
>probe:Drosophila_2:1640943_at:574:63; Interrogation_Position=1454; Antisense; ATGGGCGGATCATCGCGTTCCTGAT
>probe:Drosophila_2:1640943_at:467:697; Interrogation_Position=1520; Antisense; TTTCAACGCCAACTGATGCTGCTGA
>probe:Drosophila_2:1640943_at:227:607; Interrogation_Position=1533; Antisense; TGATGCTGCTGAGAGGACTGCCCCG
>probe:Drosophila_2:1640943_at:96:267; Interrogation_Position=1570; Antisense; CAGTTAGCACTGAGGTCGCGATCAT
>probe:Drosophila_2:1640943_at:584:79; Interrogation_Position=1582; Antisense; AGGTCGCGATCATACTCTGCAGAGT
>probe:Drosophila_2:1640943_at:275:481; Interrogation_Position=1612; Antisense; GTATTTTTCTACTTGGACCAGCATG
>probe:Drosophila_2:1640943_at:268:59; Interrogation_Position=1634; Antisense; ATGTTTGCAGCTCCTGGATCCCGTG
>probe:Drosophila_2:1640943_at:670:315; Interrogation_Position=1675; Antisense; GCCTGCTCCCTGATTTCAATAGATG
>probe:Drosophila_2:1640943_at:370:97; Interrogation_Position=1695; Antisense; AGATGCTCCGGACGTGACTCATTAG

Paste this into a BLAST search page for me
GGCCGGCCAAAGTTGTCACGCAAGTGAGCTGGCCCAGATCGCCGATAGTATTAACCTGAACGAGAGCACCGGCTTATCGGACAGCTCCAGCAATTCAAGCGATTCCAACACGGACAGCGGCCAGGATGGGCGGATCATCGCGTTCCTGATTTTCAACGCCAACTGATGCTGCTGATGATGCTGCTGAGAGGACTGCCCCGCAGTTAGCACTGAGGTCGCGATCATAGGTCGCGATCATACTCTGCAGAGTGTATTTTTCTACTTGGACCAGCATGATGTTTGCAGCTCCTGGATCCCGTGGCCTGCTCCCTGATTTCAATAGATGAGATGCTCCGGACGTGACTCATTAG

Full Affymetrix probeset data:

Annotations for 1640943_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720