Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640945_at:

>probe:Drosophila_2:1640945_at:424:695; Interrogation_Position=2661; Antisense; TTTCGGCACCCAAGCAGATGATGTC
>probe:Drosophila_2:1640945_at:694:607; Interrogation_Position=2736; Antisense; TGAGCAACAAGCTGGGACTGCCCGT
>probe:Drosophila_2:1640945_at:444:319; Interrogation_Position=2755; Antisense; GCCCGTGAAGGGACAGAATCTCGAT
>probe:Drosophila_2:1640945_at:341:111; Interrogation_Position=2769; Antisense; AGAATCTCGATCTGCACTGGTCGCA
>probe:Drosophila_2:1640945_at:273:505; Interrogation_Position=2816; Antisense; GTCCTGGTCCAGAATAAGCGCACAC
>probe:Drosophila_2:1640945_at:479:355; Interrogation_Position=2857; Antisense; GCACTCCGCCGATATGATCTACAAT
>probe:Drosophila_2:1640945_at:74:203; Interrogation_Position=2894; Antisense; AAGCCGTGGGTGTGCCGCAACTGCA
>probe:Drosophila_2:1640945_at:588:613; Interrogation_Position=2958; Antisense; TGAAGAACGAGTGCGGCTTGCCACC
>probe:Drosophila_2:1640945_at:729:127; Interrogation_Position=2980; Antisense; ACCACGCTACTTCTGCAGCAAGATG
>probe:Drosophila_2:1640945_at:333:215; Interrogation_Position=2999; Antisense; AAGATGTGCGGCTATGCCACCAATG
>probe:Drosophila_2:1640945_at:138:229; Interrogation_Position=3020; Antisense; AATGTCCACAGCAATCTGAAGCGTC
>probe:Drosophila_2:1640945_at:295:379; Interrogation_Position=3037; Antisense; GAAGCGTCACCTGAACACCAAGTGT
>probe:Drosophila_2:1640945_at:263:157; Interrogation_Position=3051; Antisense; ACACCAAGTGTCGTGATCGCGAGAA
>probe:Drosophila_2:1640945_at:13:533; Interrogation_Position=3223; Antisense; GGTGTTCCAGAACGATAGCGCTTAG

Paste this into a BLAST search page for me
TTTCGGCACCCAAGCAGATGATGTCTGAGCAACAAGCTGGGACTGCCCGTGCCCGTGAAGGGACAGAATCTCGATAGAATCTCGATCTGCACTGGTCGCAGTCCTGGTCCAGAATAAGCGCACACGCACTCCGCCGATATGATCTACAATAAGCCGTGGGTGTGCCGCAACTGCATGAAGAACGAGTGCGGCTTGCCACCACCACGCTACTTCTGCAGCAAGATGAAGATGTGCGGCTATGCCACCAATGAATGTCCACAGCAATCTGAAGCGTCGAAGCGTCACCTGAACACCAAGTGTACACCAAGTGTCGTGATCGCGAGAAGGTGTTCCAGAACGATAGCGCTTAG

Full Affymetrix probeset data:

Annotations for 1640945_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime