FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640948_at:

>probe:Drosophila_2:1640948_at:368:219; Interrogation_Position=120; Antisense; AAGTCCACGCTGAAAGTCTACAAAG
>probe:Drosophila_2:1640948_at:664:665; Interrogation_Position=146; Antisense; TACACATTCTGGTGGTGGCCTGCAC
>probe:Drosophila_2:1640948_at:366:317; Interrogation_Position=163; Antisense; GCCTGCACTTAGCTTCTGTCCAAGA
>probe:Drosophila_2:1640948_at:294:121; Interrogation_Position=202; Antisense; AGCGGCACTTTTAGGACATTTTTCA
>probe:Drosophila_2:1640948_at:380:727; Interrogation_Position=245; Antisense; TTGGTATGTTCAAGCGGCCCGTCCA
>probe:Drosophila_2:1640948_at:320:505; Interrogation_Position=265; Antisense; GTCCACGGTCACACTGGTTGAGACG
>probe:Drosophila_2:1640948_at:402:661; Interrogation_Position=311; Antisense; TAAAAGTCGAATTTCAAGCCCCACA
>probe:Drosophila_2:1640948_at:551:51; Interrogation_Position=339; Antisense; ATGCGTCTATCCTCGATCCTGAATG
>probe:Drosophila_2:1640948_at:361:359; Interrogation_Position=376; Antisense; GCAACTTGGCCAAGGTGCACGGCAT
>probe:Drosophila_2:1640948_at:239:223; Interrogation_Position=456; Antisense; AAGGGACTGCCCAACATGGTGCGTC
>probe:Drosophila_2:1640948_at:483:305; Interrogation_Position=514; Antisense; CCTTCATCGTGGGATACCTGATCTA
>probe:Drosophila_2:1640948_at:192:453; Interrogation_Position=533; Antisense; GATCTACGATCTGACCGAACGCAAG
>probe:Drosophila_2:1640948_at:151:239; Interrogation_Position=604; Antisense; AATAAGCGTCCCAACTAGCAGATAG
>probe:Drosophila_2:1640948_at:160:717; Interrogation_Position=682; Antisense; TTCGGTTGCTGGAAGGCTAAACACC

Paste this into a BLAST search page for me
AAGTCCACGCTGAAAGTCTACAAAGTACACATTCTGGTGGTGGCCTGCACGCCTGCACTTAGCTTCTGTCCAAGAAGCGGCACTTTTAGGACATTTTTCATTGGTATGTTCAAGCGGCCCGTCCAGTCCACGGTCACACTGGTTGAGACGTAAAAGTCGAATTTCAAGCCCCACAATGCGTCTATCCTCGATCCTGAATGGCAACTTGGCCAAGGTGCACGGCATAAGGGACTGCCCAACATGGTGCGTCCCTTCATCGTGGGATACCTGATCTAGATCTACGATCTGACCGAACGCAAGAATAAGCGTCCCAACTAGCAGATAGTTCGGTTGCTGGAAGGCTAAACACC

Full Affymetrix probeset data:

Annotations for 1640948_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720