FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640950_at:

>probe:Drosophila_2:1640950_at:500:3; Interrogation_Position=1036; Antisense; ATTGGCTATAGCTGTACCTGGGTAC
>probe:Drosophila_2:1640950_at:635:669; Interrogation_Position=1050; Antisense; TACCTGGGTACCTGGGTAGCTGATA
>probe:Drosophila_2:1640950_at:458:487; Interrogation_Position=1065; Antisense; GTAGCTGATATAGTGTCGTATTCCT
>probe:Drosophila_2:1640950_at:515:501; Interrogation_Position=1079; Antisense; GTCGTATTCCTAACCAGATCACATT
>probe:Drosophila_2:1640950_at:231:455; Interrogation_Position=1095; Antisense; GATCACATTCTGTCTGCGAAATTTG
>probe:Drosophila_2:1640950_at:281:173; Interrogation_Position=1170; Antisense; AAACCACTGCAACCATTTGGTCGTA
>probe:Drosophila_2:1640950_at:427:119; Interrogation_Position=1323; Antisense; AGCGATCGAACTTTGGGATACCCCG
>probe:Drosophila_2:1640950_at:425:457; Interrogation_Position=1339; Antisense; GATACCCCGCAATTCACAGTGTAAA
>probe:Drosophila_2:1640950_at:399:137; Interrogation_Position=825; Antisense; ACGTTAGCTTTGGACGCCAGTGCGG
>probe:Drosophila_2:1640950_at:253:87; Interrogation_Position=843; Antisense; AGTGCGGATTCCAAACGCTGCTCGT
>probe:Drosophila_2:1640950_at:14:285; Interrogation_Position=860; Antisense; CTGCTCGTGCTCAGCGGCGGATGCA
>probe:Drosophila_2:1640950_at:591:577; Interrogation_Position=901; Antisense; GGCCGAGACGGATCCGCAGCGCATA
>probe:Drosophila_2:1640950_at:258:147; Interrogation_Position=930; Antisense; ACTACTATGCGGACAGCGTGGCCGA
>probe:Drosophila_2:1640950_at:348:439; Interrogation_Position=974; Antisense; GAGGCGCCCAAGTCGCGTGTCTAGA

Paste this into a BLAST search page for me
ATTGGCTATAGCTGTACCTGGGTACTACCTGGGTACCTGGGTAGCTGATAGTAGCTGATATAGTGTCGTATTCCTGTCGTATTCCTAACCAGATCACATTGATCACATTCTGTCTGCGAAATTTGAAACCACTGCAACCATTTGGTCGTAAGCGATCGAACTTTGGGATACCCCGGATACCCCGCAATTCACAGTGTAAAACGTTAGCTTTGGACGCCAGTGCGGAGTGCGGATTCCAAACGCTGCTCGTCTGCTCGTGCTCAGCGGCGGATGCAGGCCGAGACGGATCCGCAGCGCATAACTACTATGCGGACAGCGTGGCCGAGAGGCGCCCAAGTCGCGTGTCTAGA

Full Affymetrix probeset data:

Annotations for 1640950_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720