FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640952_at:

>probe:Drosophila_2:1640952_at:41:423; Interrogation_Position=3128; Antisense; GAGAATGTGTCCATTGCGACCGTCA
>probe:Drosophila_2:1640952_at:711:325; Interrogation_Position=3143; Antisense; GCGACCGTCAACTCCATGTGCATGG
>probe:Drosophila_2:1640952_at:138:547; Interrogation_Position=3166; Antisense; GGAGGCCACCTACCAGAAGTACGAC
>probe:Drosophila_2:1640952_at:498:75; Interrogation_Position=3201; Antisense; AGGAGTATTCGGGAGCGCCTGTCCA
>probe:Drosophila_2:1640952_at:580:629; Interrogation_Position=3222; Antisense; TCCAGTGCCTGATTCCCGGAACGAA
>probe:Drosophila_2:1640952_at:203:289; Interrogation_Position=3238; Antisense; CGGAACGAATCAGTGGGCGCTCATT
>probe:Drosophila_2:1640952_at:580:587; Interrogation_Position=3303; Antisense; TGGAGCGGCCCAGGATGTACGACAA
>probe:Drosophila_2:1640952_at:402:443; Interrogation_Position=3316; Antisense; GATGTACGACAAGATCGCCTCGAAT
>probe:Drosophila_2:1640952_at:389:1; Interrogation_Position=3371; Antisense; ATATAGTCGGGATAGTTCACCAGGG
>probe:Drosophila_2:1640952_at:339:321; Interrogation_Position=3407; Antisense; GCCCCTCAGCGCATTTGTGTAGAAA
>probe:Drosophila_2:1640952_at:429:489; Interrogation_Position=3498; Antisense; GTACTATGTAACTAACCTGCTCTAA
>probe:Drosophila_2:1640952_at:136:129; Interrogation_Position=3512; Antisense; ACCTGCTCTAATGTTACTCGAACCT
>probe:Drosophila_2:1640952_at:159:493; Interrogation_Position=3539; Antisense; GTAACTCTATGCTAACTGTATTCTT
>probe:Drosophila_2:1640952_at:440:475; Interrogation_Position=3655; Antisense; GTTAGTCTGTACGTTTAGCTGTTTG

Paste this into a BLAST search page for me
GAGAATGTGTCCATTGCGACCGTCAGCGACCGTCAACTCCATGTGCATGGGGAGGCCACCTACCAGAAGTACGACAGGAGTATTCGGGAGCGCCTGTCCATCCAGTGCCTGATTCCCGGAACGAACGGAACGAATCAGTGGGCGCTCATTTGGAGCGGCCCAGGATGTACGACAAGATGTACGACAAGATCGCCTCGAATATATAGTCGGGATAGTTCACCAGGGGCCCCTCAGCGCATTTGTGTAGAAAGTACTATGTAACTAACCTGCTCTAAACCTGCTCTAATGTTACTCGAACCTGTAACTCTATGCTAACTGTATTCTTGTTAGTCTGTACGTTTAGCTGTTTG

Full Affymetrix probeset data:

Annotations for 1640952_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720