Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640954_at:

>probe:Drosophila_2:1640954_at:622:175; Interrogation_Position=301; Antisense; AAACCTATCGGCACAACGACACTTT
>probe:Drosophila_2:1640954_at:438:197; Interrogation_Position=315; Antisense; AACGACACTTTCTCAATAGCTATAG
>probe:Drosophila_2:1640954_at:457:555; Interrogation_Position=371; Antisense; GGACGAGGTCTTTAGCCTACACATG
>probe:Drosophila_2:1640954_at:334:305; Interrogation_Position=386; Antisense; CCTACACATGGAGAAATTGGACGTT
>probe:Drosophila_2:1640954_at:416:671; Interrogation_Position=411; Antisense; TACGACGTTCTCTTTTTGGCCGGCA
>probe:Drosophila_2:1640954_at:291:727; Interrogation_Position=426; Antisense; TTGGCCGGCATTATCTCCGTGATAA
>probe:Drosophila_2:1640954_at:58:3; Interrogation_Position=473; Antisense; ATTGGATCGCAATCGGACGGAAATG
>probe:Drosophila_2:1640954_at:48:295; Interrogation_Position=513; Antisense; CGATGTATGCGTTGTTTTGTTGTGA
>probe:Drosophila_2:1640954_at:640:661; Interrogation_Position=548; Antisense; TAAAACAGCTGTTCATTAGCCCTCC
>probe:Drosophila_2:1640954_at:585:703; Interrogation_Position=563; Antisense; TTAGCCCTCCCAGTGTTGCAAAATG
>probe:Drosophila_2:1640954_at:253:185; Interrogation_Position=582; Antisense; AAAATGCGCTGCCTACACTGCCCAG
>probe:Drosophila_2:1640954_at:92:661; Interrogation_Position=665; Antisense; TAAAACTCACCCAAAACCATAGCCA
>probe:Drosophila_2:1640954_at:27:265; Interrogation_Position=716; Antisense; CAGACACTTTATTTGGTTTGCTCAG
>probe:Drosophila_2:1640954_at:101:729; Interrogation_Position=728; Antisense; TTGGTTTGCTCAGACTTTCACTTTT

Paste this into a BLAST search page for me
AAACCTATCGGCACAACGACACTTTAACGACACTTTCTCAATAGCTATAGGGACGAGGTCTTTAGCCTACACATGCCTACACATGGAGAAATTGGACGTTTACGACGTTCTCTTTTTGGCCGGCATTGGCCGGCATTATCTCCGTGATAAATTGGATCGCAATCGGACGGAAATGCGATGTATGCGTTGTTTTGTTGTGATAAAACAGCTGTTCATTAGCCCTCCTTAGCCCTCCCAGTGTTGCAAAATGAAAATGCGCTGCCTACACTGCCCAGTAAAACTCACCCAAAACCATAGCCACAGACACTTTATTTGGTTTGCTCAGTTGGTTTGCTCAGACTTTCACTTTT

Full Affymetrix probeset data:

Annotations for 1640954_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime