Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640956_at:

>probe:Drosophila_2:1640956_at:551:621; Interrogation_Position=1649; Antisense; TGCTGCAGGCTCCATACTACAATTA
>probe:Drosophila_2:1640956_at:722:163; Interrogation_Position=1693; Antisense; AAATATGCGCTATTGGGCCATCGAT
>probe:Drosophila_2:1640956_at:159:581; Interrogation_Position=1718; Antisense; TGGCCAGTGCATTGGTTCAGGCATT
>probe:Drosophila_2:1640956_at:347:435; Interrogation_Position=1792; Antisense; GAGGTGACCATGTCTGGTTACCGAA
>probe:Drosophila_2:1640956_at:337:49; Interrogation_Position=1827; Antisense; ATGCCAACGGGCTCAGTACAGTAGT
>probe:Drosophila_2:1640956_at:75:365; Interrogation_Position=1873; Antisense; GAATTTCGCAATGCCACCAGGCTAA
>probe:Drosophila_2:1640956_at:262:349; Interrogation_Position=1916; Antisense; GCAGTGGTCTCAACTTGGCCTTCAA
>probe:Drosophila_2:1640956_at:656:651; Interrogation_Position=1937; Antisense; TCAACGCGTATCTAGCTTGGCTGGA
>probe:Drosophila_2:1640956_at:440:339; Interrogation_Position=1977; Antisense; GCTACGTCCACTACTGGCGAAGGAA
>probe:Drosophila_2:1640956_at:562:341; Interrogation_Position=2034; Antisense; GCTATTCTTCATATACTTCGCACAG
>probe:Drosophila_2:1640956_at:172:105; Interrogation_Position=2057; Antisense; AGACGCGCTGCTGGGCAAAGGACAA
>probe:Drosophila_2:1640956_at:306:587; Interrogation_Position=2096; Antisense; TGGACTCGATGCCTCTGATGCAGCA
>probe:Drosophila_2:1640956_at:663:11; Interrogation_Position=2169; Antisense; ATTCGGACGAGAGTTCGGCTGTGCC
>probe:Drosophila_2:1640956_at:434:625; Interrogation_Position=2190; Antisense; TGCCCTGGGCACACCGATGAATAGT

Paste this into a BLAST search page for me
TGCTGCAGGCTCCATACTACAATTAAAATATGCGCTATTGGGCCATCGATTGGCCAGTGCATTGGTTCAGGCATTGAGGTGACCATGTCTGGTTACCGAAATGCCAACGGGCTCAGTACAGTAGTGAATTTCGCAATGCCACCAGGCTAAGCAGTGGTCTCAACTTGGCCTTCAATCAACGCGTATCTAGCTTGGCTGGAGCTACGTCCACTACTGGCGAAGGAAGCTATTCTTCATATACTTCGCACAGAGACGCGCTGCTGGGCAAAGGACAATGGACTCGATGCCTCTGATGCAGCAATTCGGACGAGAGTTCGGCTGTGCCTGCCCTGGGCACACCGATGAATAGT

Full Affymetrix probeset data:

Annotations for 1640956_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime