FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640957_at:

>probe:Drosophila_2:1640957_at:215:673; Interrogation_Position=1593; Antisense; TACCTGCCCAAGGAGCGGTTCATAA
>probe:Drosophila_2:1640957_at:59:533; Interrogation_Position=1628; Antisense; GGTGGAGTCACAGGATGCCCTCAAT
>probe:Drosophila_2:1640957_at:504:439; Interrogation_Position=1669; Antisense; GAGGCTACCGACTGATTGTGTCCAC
>probe:Drosophila_2:1640957_at:147:211; Interrogation_Position=1695; Antisense; AAGAATGCCTGGTACCTGGATCACG
>probe:Drosophila_2:1640957_at:277:113; Interrogation_Position=1731; Antisense; AGCACATCGTACTACAACTGGCGCA
>probe:Drosophila_2:1640957_at:223:347; Interrogation_Position=1771; Antisense; GCATGCCCGTTGGTCGCAGCAAGGA
>probe:Drosophila_2:1640957_at:9:265; Interrogation_Position=1787; Antisense; CAGCAAGGATCAGGTTCTCGGCGGT
>probe:Drosophila_2:1640957_at:411:383; Interrogation_Position=1844; Antisense; GAACTCACTGGAATCCCGAATCTGG
>probe:Drosophila_2:1640957_at:45:165; Interrogation_Position=1904; Antisense; AAATCCAAAGTCTTCAGCCCTGTTG
>probe:Drosophila_2:1640957_at:250:211; Interrogation_Position=1934; Antisense; AAGAAGATTCTACCGCTACCGGGAG
>probe:Drosophila_2:1640957_at:312:547; Interrogation_Position=1985; Antisense; GGATGCAGTTATTCCGCACTGGTGC
>probe:Drosophila_2:1640957_at:709:557; Interrogation_Position=2022; Antisense; GGACAGTGCCTCTAAATCGGTCGTT
>probe:Drosophila_2:1640957_at:9:471; Interrogation_Position=2044; Antisense; GTTCCGAACCTAGTTTTAGCACCAG
>probe:Drosophila_2:1640957_at:10:699; Interrogation_Position=2058; Antisense; TTTAGCACCAGCACATACCATGTAC

Paste this into a BLAST search page for me
TACCTGCCCAAGGAGCGGTTCATAAGGTGGAGTCACAGGATGCCCTCAATGAGGCTACCGACTGATTGTGTCCACAAGAATGCCTGGTACCTGGATCACGAGCACATCGTACTACAACTGGCGCAGCATGCCCGTTGGTCGCAGCAAGGACAGCAAGGATCAGGTTCTCGGCGGTGAACTCACTGGAATCCCGAATCTGGAAATCCAAAGTCTTCAGCCCTGTTGAAGAAGATTCTACCGCTACCGGGAGGGATGCAGTTATTCCGCACTGGTGCGGACAGTGCCTCTAAATCGGTCGTTGTTCCGAACCTAGTTTTAGCACCAGTTTAGCACCAGCACATACCATGTAC

Full Affymetrix probeset data:

Annotations for 1640957_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720