FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640958_at:

>probe:Drosophila_2:1640958_at:143:593; Interrogation_Position=109; Antisense; TGGGTGCGGCGCAACACGAATCCCA
>probe:Drosophila_2:1640958_at:195:299; Interrogation_Position=14; Antisense; CGCTTGTTTACATTTTGCATCTTTA
>probe:Drosophila_2:1640958_at:653:607; Interrogation_Position=170; Antisense; TGAGCATCGGGTACGCCGTTCTGGC
>probe:Drosophila_2:1640958_at:193:579; Interrogation_Position=208; Antisense; GGCCTCGTTTGCTATATGGTCTACA
>probe:Drosophila_2:1640958_at:26:25; Interrogation_Position=221; Antisense; ATATGGTCTACACCGGACGCAACGA
>probe:Drosophila_2:1640958_at:443:553; Interrogation_Position=235; Antisense; GGACGCAACGACTGGGCCAAGTACT
>probe:Drosophila_2:1640958_at:50:579; Interrogation_Position=249; Antisense; GGCCAAGTACTACGGCTACAAGACG
>probe:Drosophila_2:1640958_at:250:189; Interrogation_Position=302; Antisense; AACAGTTCGCCAAGCACCTGAAGGT
>probe:Drosophila_2:1640958_at:29:37; Interrogation_Position=343; Antisense; ATCATCAGGTTCTCTGGATTCCACA
>probe:Drosophila_2:1640958_at:155:77; Interrogation_Position=413; Antisense; AGGAGTAACTGTAGTTCCCACCAGC
>probe:Drosophila_2:1640958_at:338:309; Interrogation_Position=433; Antisense; CCAGCTCAGTGAACCATTATTTTTT
>probe:Drosophila_2:1640958_at:42:127; Interrogation_Position=461; Antisense; AGCCATCGTATGTTTATTGCCATTA
>probe:Drosophila_2:1640958_at:156:113; Interrogation_Position=68; Antisense; AGCACACAATGGCACTGTTCGAGAT
>probe:Drosophila_2:1640958_at:79:717; Interrogation_Position=85; Antisense; TTCGAGATGAAGTGGCTGCGCCGCT

Paste this into a BLAST search page for me
TGGGTGCGGCGCAACACGAATCCCACGCTTGTTTACATTTTGCATCTTTATGAGCATCGGGTACGCCGTTCTGGCGGCCTCGTTTGCTATATGGTCTACAATATGGTCTACACCGGACGCAACGAGGACGCAACGACTGGGCCAAGTACTGGCCAAGTACTACGGCTACAAGACGAACAGTTCGCCAAGCACCTGAAGGTATCATCAGGTTCTCTGGATTCCACAAGGAGTAACTGTAGTTCCCACCAGCCCAGCTCAGTGAACCATTATTTTTTAGCCATCGTATGTTTATTGCCATTAAGCACACAATGGCACTGTTCGAGATTTCGAGATGAAGTGGCTGCGCCGCT

Full Affymetrix probeset data:

Annotations for 1640958_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720