FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640959_at:

>probe:Drosophila_2:1640959_at:231:579; Interrogation_Position=1501; Antisense; TGGCGGCCTGACTGGAGATCGTTTA
>probe:Drosophila_2:1640959_at:444:97; Interrogation_Position=1516; Antisense; AGATCGTTTATGGAGGCTGCCCTTG
>probe:Drosophila_2:1640959_at:421:37; Interrogation_Position=1572; Antisense; ATCTCACCTTCGACATCAGCAATAG
>probe:Drosophila_2:1640959_at:186:137; Interrogation_Position=1641; Antisense; ACGAACTGGTTCCATGCGCGGATTG
>probe:Drosophila_2:1640959_at:704:727; Interrogation_Position=1663; Antisense; TTGGGCCCACATTGATATCCGGAAT
>probe:Drosophila_2:1640959_at:82:627; Interrogation_Position=1716; Antisense; TGCCGTATCTGCTCAAGGATCGGAT
>probe:Drosophila_2:1640959_at:183:491; Interrogation_Position=1766; Antisense; GTACAGTTCCTGTATCAGATGGCCT
>probe:Drosophila_2:1640959_at:418:265; Interrogation_Position=1781; Antisense; CAGATGGCCTGTCCGGAAAGCAAGT
>probe:Drosophila_2:1640959_at:534:171; Interrogation_Position=1797; Antisense; AAAGCAAGTAGTCTCCGGATCTGGA
>probe:Drosophila_2:1640959_at:255:673; Interrogation_Position=1845; Antisense; TACCACCATTGCTCGTTCTATTTTA
>probe:Drosophila_2:1640959_at:494:729; Interrogation_Position=1935; Antisense; TTGGTTTAGTGTTCCGTGAGCAGCT
>probe:Drosophila_2:1640959_at:341:421; Interrogation_Position=1952; Antisense; GAGCAGCTGGGTAACGACACATTGA
>probe:Drosophila_2:1640959_at:325:93; Interrogation_Position=2026; Antisense; AGTTCGACTGGCTTCTATGGATCGT
>probe:Drosophila_2:1640959_at:251:639; Interrogation_Position=2047; Antisense; TCGTCTCCCAGCTGCACAAAATTAA

Paste this into a BLAST search page for me
TGGCGGCCTGACTGGAGATCGTTTAAGATCGTTTATGGAGGCTGCCCTTGATCTCACCTTCGACATCAGCAATAGACGAACTGGTTCCATGCGCGGATTGTTGGGCCCACATTGATATCCGGAATTGCCGTATCTGCTCAAGGATCGGATGTACAGTTCCTGTATCAGATGGCCTCAGATGGCCTGTCCGGAAAGCAAGTAAAGCAAGTAGTCTCCGGATCTGGATACCACCATTGCTCGTTCTATTTTATTGGTTTAGTGTTCCGTGAGCAGCTGAGCAGCTGGGTAACGACACATTGAAGTTCGACTGGCTTCTATGGATCGTTCGTCTCCCAGCTGCACAAAATTAA

Full Affymetrix probeset data:

Annotations for 1640959_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720