Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640960_at:

>probe:Drosophila_2:1640960_at:279:401; Interrogation_Position=1178; Antisense; GACATGCGGCGTACTGGCTGGTCAT
>probe:Drosophila_2:1640960_at:279:41; Interrogation_Position=1201; Antisense; ATCTGTCCCAGAACCAGCTGTACAT
>probe:Drosophila_2:1640960_at:730:119; Interrogation_Position=1216; Antisense; AGCTGTACATCACTCACATCATTAC
>probe:Drosophila_2:1640960_at:545:225; Interrogation_Position=1252; Antisense; AAGGAACTCCGGACAGCTGCAACAC
>probe:Drosophila_2:1640960_at:274:13; Interrogation_Position=1338; Antisense; ATTCATACTCATCCAACTCAGACTG
>probe:Drosophila_2:1640960_at:123:105; Interrogation_Position=1357; Antisense; AGACTGCGTTTTTGTCCTCCGTTGA
>probe:Drosophila_2:1640960_at:715:271; Interrogation_Position=1386; Antisense; CATACGCATTGCTCCTATCAGATTA
>probe:Drosophila_2:1640960_at:688:377; Interrogation_Position=1419; Antisense; GAAGCTTTGGCTATTGTGTGCGCGC
>probe:Drosophila_2:1640960_at:578:515; Interrogation_Position=1434; Antisense; GTGTGCGCGCCTAAGTACAATACTA
>probe:Drosophila_2:1640960_at:284:479; Interrogation_Position=1462; Antisense; GTTTCTTTATACTCACGCCACATTA
>probe:Drosophila_2:1640960_at:336:669; Interrogation_Position=1485; Antisense; TACGGTCTGGACTACATAGCCCAAT
>probe:Drosophila_2:1640960_at:276:439; Interrogation_Position=1560; Antisense; GAGGCGCAGCACATCCGAATGGATA
>probe:Drosophila_2:1640960_at:242:679; Interrogation_Position=1620; Antisense; TAGTCACTCAAAAGCACCGATCCAT
>probe:Drosophila_2:1640960_at:167:243; Interrogation_Position=1655; Antisense; AATAGCTCCAGTTTCGGTTGTCAAA

Paste this into a BLAST search page for me
GACATGCGGCGTACTGGCTGGTCATATCTGTCCCAGAACCAGCTGTACATAGCTGTACATCACTCACATCATTACAAGGAACTCCGGACAGCTGCAACACATTCATACTCATCCAACTCAGACTGAGACTGCGTTTTTGTCCTCCGTTGACATACGCATTGCTCCTATCAGATTAGAAGCTTTGGCTATTGTGTGCGCGCGTGTGCGCGCCTAAGTACAATACTAGTTTCTTTATACTCACGCCACATTATACGGTCTGGACTACATAGCCCAATGAGGCGCAGCACATCCGAATGGATATAGTCACTCAAAAGCACCGATCCATAATAGCTCCAGTTTCGGTTGTCAAA

Full Affymetrix probeset data:

Annotations for 1640960_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime