FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640961_at:

>probe:Drosophila_2:1640961_at:60:493; Interrogation_Position=174; Antisense; GTAATCAGCCCATGGTTCTGGACGA
>probe:Drosophila_2:1640961_at:481:25; Interrogation_Position=281; Antisense; ATACCTGTATGCAACGGACCCAATA
>probe:Drosophila_2:1640961_at:358:35; Interrogation_Position=305; Antisense; ATCAGCAAAGCACCTTCAAGTCGTC
>probe:Drosophila_2:1640961_at:723:251; Interrogation_Position=321; Antisense; CAAGTCGTCTGCGTTTTCCGGGAGG
>probe:Drosophila_2:1640961_at:48:693; Interrogation_Position=370; Antisense; TTTGGTTTCATTACCGAGGCTTCGC
>probe:Drosophila_2:1640961_at:128:477; Interrogation_Position=407; Antisense; GTATTACAGGTTTACGGCCATGATA
>probe:Drosophila_2:1640961_at:669:591; Interrogation_Position=493; Antisense; TGGTGAGATATGCTCCTCCTGGAAA
>probe:Drosophila_2:1640961_at:94:427; Interrogation_Position=526; Antisense; GAGAGATGGCGTCCAATGTTCCCAA
>probe:Drosophila_2:1640961_at:225:253; Interrogation_Position=548; Antisense; CAAGCGACCGACAACGTTTTGGGAT
>probe:Drosophila_2:1640961_at:316:411; Interrogation_Position=588; Antisense; GACCATGGGTTTGAGTTCGCATAAC
>probe:Drosophila_2:1640961_at:247:273; Interrogation_Position=612; Antisense; CATTTGCTCGCAATGGCGTCAACAA
>probe:Drosophila_2:1640961_at:135:537; Interrogation_Position=644; Antisense; GGTAACTGGCTGTCTTTCGTAACGA
>probe:Drosophila_2:1640961_at:32:243; Interrogation_Position=677; Antisense; AATTTATATCTGTGCGGAACTTCCA
>probe:Drosophila_2:1640961_at:596:459; Interrogation_Position=712; Antisense; GATTTTCCAGCGGTATTCGAACTAA

Paste this into a BLAST search page for me
GTAATCAGCCCATGGTTCTGGACGAATACCTGTATGCAACGGACCCAATAATCAGCAAAGCACCTTCAAGTCGTCCAAGTCGTCTGCGTTTTCCGGGAGGTTTGGTTTCATTACCGAGGCTTCGCGTATTACAGGTTTACGGCCATGATATGGTGAGATATGCTCCTCCTGGAAAGAGAGATGGCGTCCAATGTTCCCAACAAGCGACCGACAACGTTTTGGGATGACCATGGGTTTGAGTTCGCATAACCATTTGCTCGCAATGGCGTCAACAAGGTAACTGGCTGTCTTTCGTAACGAAATTTATATCTGTGCGGAACTTCCAGATTTTCCAGCGGTATTCGAACTAA

Full Affymetrix probeset data:

Annotations for 1640961_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720