Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640963_at:

>probe:Drosophila_2:1640963_at:412:261; Interrogation_Position=4516; Antisense; CACCGATCATACAGAACCACCAATG
>probe:Drosophila_2:1640963_at:620:105; Interrogation_Position=4528; Antisense; AGAACCACCAATGCGTGACCTTTCG
>probe:Drosophila_2:1640963_at:691:411; Interrogation_Position=4543; Antisense; TGACCTTTCGCTGTACCAAAACCAT
>probe:Drosophila_2:1640963_at:283:173; Interrogation_Position=4561; Antisense; AAACCATAGCCTACAGTTAGTCGTA
>probe:Drosophila_2:1640963_at:166:713; Interrogation_Position=4605; Antisense; TTCATAACTCGCAATGTTCGTCAGT
>probe:Drosophila_2:1640963_at:585:471; Interrogation_Position=4620; Antisense; GTTCGTCAGTTGTAAGTGGCCCATG
>probe:Drosophila_2:1640963_at:691:221; Interrogation_Position=4633; Antisense; AAGTGGCCCATGTATATAGTCGCAT
>probe:Drosophila_2:1640963_at:572:25; Interrogation_Position=4648; Antisense; ATAGTCGCATGTAGGCTGGGATCTT
>probe:Drosophila_2:1640963_at:48:451; Interrogation_Position=4667; Antisense; GATCTTGCCCAAAAATATCCAGGTG
>probe:Drosophila_2:1640963_at:625:519; Interrogation_Position=4689; Antisense; GTGGATTAGCCATATCCCACCAAAT
>probe:Drosophila_2:1640963_at:215:311; Interrogation_Position=4744; Antisense; GCCAAAATGTGGTGCTCTTAAATGT
>probe:Drosophila_2:1640963_at:509:685; Interrogation_Position=4910; Antisense; TATTGATCCCTATAGCTTTCGAAAA
>probe:Drosophila_2:1640963_at:219:563; Interrogation_Position=5002; Antisense; GGAAGCCCATTTTTGTTTACGATAT
>probe:Drosophila_2:1640963_at:245:655; Interrogation_Position=5042; Antisense; TAATATTATATTTCCCATTTCCCAA

Paste this into a BLAST search page for me
CACCGATCATACAGAACCACCAATGAGAACCACCAATGCGTGACCTTTCGTGACCTTTCGCTGTACCAAAACCATAAACCATAGCCTACAGTTAGTCGTATTCATAACTCGCAATGTTCGTCAGTGTTCGTCAGTTGTAAGTGGCCCATGAAGTGGCCCATGTATATAGTCGCATATAGTCGCATGTAGGCTGGGATCTTGATCTTGCCCAAAAATATCCAGGTGGTGGATTAGCCATATCCCACCAAATGCCAAAATGTGGTGCTCTTAAATGTTATTGATCCCTATAGCTTTCGAAAAGGAAGCCCATTTTTGTTTACGATATTAATATTATATTTCCCATTTCCCAA

Full Affymetrix probeset data:

Annotations for 1640963_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime