Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640964_at:

>probe:Drosophila_2:1640964_at:202:183; Interrogation_Position=1360; Antisense; AAAAGCATGGCAAGGCCTGCTCCTG
>probe:Drosophila_2:1640964_at:614:615; Interrogation_Position=1383; Antisense; TGCAGCTACCACCTCCAGAAGAAGC
>probe:Drosophila_2:1640964_at:458:211; Interrogation_Position=1401; Antisense; AAGAAGCGCCTCCAGGATCGGGATA
>probe:Drosophila_2:1640964_at:295:445; Interrogation_Position=1439; Antisense; GATGACCGAGCGGAGGATCCTTTCG
>probe:Drosophila_2:1640964_at:399:49; Interrogation_Position=1512; Antisense; ATGCCCTGTCTTTGATATTACGCTG
>probe:Drosophila_2:1640964_at:648:283; Interrogation_Position=1534; Antisense; CTGTTTGTAAATGTCTCGCGTGTTA
>probe:Drosophila_2:1640964_at:94:297; Interrogation_Position=1550; Antisense; CGCGTGTTAATTACCTGCCGAGCAA
>probe:Drosophila_2:1640964_at:560:341; Interrogation_Position=1584; Antisense; GCATGACTTAACCATTTACCCAGCT
>probe:Drosophila_2:1640964_at:184:309; Interrogation_Position=1603; Antisense; CCAGCTCAGTTCCTTTGTTCGAAAA
>probe:Drosophila_2:1640964_at:593:389; Interrogation_Position=1641; Antisense; GTAATCGGGAAAGCTCTTGGGCGCC
>probe:Drosophila_2:1640964_at:157:717; Interrogation_Position=1657; Antisense; TTGGGCGCCCTCAGAAGTCAACTGG
>probe:Drosophila_2:1640964_at:550:195; Interrogation_Position=1676; Antisense; AACTGGCAGCCTCGCCAACAATGGG
>probe:Drosophila_2:1640964_at:273:519; Interrogation_Position=1713; Antisense; GGGCGTCCCACACGGTGAAATCGAT
>probe:Drosophila_2:1640964_at:371:11; Interrogation_Position=1787; Antisense; ATTCTACCAACATATCCTACACTAA

Paste this into a BLAST search page for me
AAAAGCATGGCAAGGCCTGCTCCTGTGCAGCTACCACCTCCAGAAGAAGCAAGAAGCGCCTCCAGGATCGGGATAGATGACCGAGCGGAGGATCCTTTCGATGCCCTGTCTTTGATATTACGCTGCTGTTTGTAAATGTCTCGCGTGTTACGCGTGTTAATTACCTGCCGAGCAAGCATGACTTAACCATTTACCCAGCTCCAGCTCAGTTCCTTTGTTCGAAAAGTAATCGGGAAAGCTCTTGGGCGCCTTGGGCGCCCTCAGAAGTCAACTGGAACTGGCAGCCTCGCCAACAATGGGGGGCGTCCCACACGGTGAAATCGATATTCTACCAACATATCCTACACTAA

Full Affymetrix probeset data:

Annotations for 1640964_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime