FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640965_at:

>probe:Drosophila_2:1640965_at:412:173; Interrogation_Position=1315; Antisense; AAAGCACACCTACCATGCTGGTTAC
>probe:Drosophila_2:1640965_at:35:51; Interrogation_Position=1329; Antisense; ATGCTGGTTACCTTATCCTTGTCAT
>probe:Drosophila_2:1640965_at:201:705; Interrogation_Position=1341; Antisense; TTATCCTTGTCATCTGGCAAATCCC
>probe:Drosophila_2:1640965_at:205:585; Interrogation_Position=1355; Antisense; TGGCAAATCCCCAGTGTTATTAAAC
>probe:Drosophila_2:1640965_at:161:21; Interrogation_Position=1419; Antisense; ATATTGCCTTCGTTAACCTTTGCAC
>probe:Drosophila_2:1640965_at:123:723; Interrogation_Position=1438; Antisense; TTGCACTCACTCATCGACGTTATGA
>probe:Drosophila_2:1640965_at:347:115; Interrogation_Position=1467; Antisense; AGCATTGCAGTTACGATTAACCTCG
>probe:Drosophila_2:1640965_at:33:185; Interrogation_Position=1494; Antisense; AAAATCTACGTAGTCAGCCTCTCTA
>probe:Drosophila_2:1640965_at:358:15; Interrogation_Position=1593; Antisense; ATTATCCTTGGCGTGATCCTGTAGA
>probe:Drosophila_2:1640965_at:338:513; Interrogation_Position=1605; Antisense; GTGATCCTGTAGAGCCCTGGCACAA
>probe:Drosophila_2:1640965_at:549:355; Interrogation_Position=1660; Antisense; GCACAAGCTCTAACTAACGCGGAAT
>probe:Drosophila_2:1640965_at:346:543; Interrogation_Position=1713; Antisense; GGATTCTGTGACTGACCTTTTATAG
>probe:Drosophila_2:1640965_at:621:25; Interrogation_Position=1734; Antisense; ATAGATCACATTCTCATGCATTGAA
>probe:Drosophila_2:1640965_at:577:363; Interrogation_Position=1756; Antisense; GAATAGATTTCATTGTGCCATGCAC

Paste this into a BLAST search page for me
AAAGCACACCTACCATGCTGGTTACATGCTGGTTACCTTATCCTTGTCATTTATCCTTGTCATCTGGCAAATCCCTGGCAAATCCCCAGTGTTATTAAACATATTGCCTTCGTTAACCTTTGCACTTGCACTCACTCATCGACGTTATGAAGCATTGCAGTTACGATTAACCTCGAAAATCTACGTAGTCAGCCTCTCTAATTATCCTTGGCGTGATCCTGTAGAGTGATCCTGTAGAGCCCTGGCACAAGCACAAGCTCTAACTAACGCGGAATGGATTCTGTGACTGACCTTTTATAGATAGATCACATTCTCATGCATTGAAGAATAGATTTCATTGTGCCATGCAC

Full Affymetrix probeset data:

Annotations for 1640965_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720